ID: 1010825041

View in Genome Browser
Species Human (GRCh38)
Location 6:80462889-80462911
Sequence GCTCCCAGTGCATCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010825041_1010825042 2 Left 1010825041 6:80462889-80462911 CCAGATTGTGATGCACTGGGAGC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1010825042 6:80462914-80462936 GCCACCATGAACATATCCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010825041 Original CRISPR GCTCCCAGTGCATCACAATC TGG (reversed) Intergenic
904285191 1:29449507-29449529 TCTCCCACTGAATCACAAACAGG + Intergenic
905472794 1:38206134-38206156 GTGGCCAGTGCATCACAATGTGG + Intergenic
917200015 1:172504860-172504882 TCTCCGAGTGCATCCCATTCAGG - Intergenic
920943505 1:210506155-210506177 CCTCACAGTGCATCAAAATTAGG - Intronic
922151161 1:223005468-223005490 CCACCCAGTGCAGCACATTCAGG + Exonic
1066252231 10:33645798-33645820 GCTCCAGGAGCTTCACAATCTGG + Intergenic
1066289187 10:33998494-33998516 GCTCTCAGTCCTTCACACTCAGG + Intergenic
1070787552 10:79170808-79170830 GCTCCACGTGGCTCACAATCTGG + Intronic
1075786247 10:125052172-125052194 GCTGCCCCTGCATCACAACCAGG - Intronic
1076184377 10:128434877-128434899 TCTCCTAGTGGATCCCAATCAGG + Intergenic
1076620014 10:131781073-131781095 TCTCCCAGTGCAGAACAATGCGG - Intergenic
1083375902 11:62220894-62220916 GTTCCCAGTACATCAACATCAGG + Intergenic
1084570995 11:69959760-69959782 GCCCCCAGTGAATGACAAGCTGG - Intergenic
1086890476 11:92252727-92252749 GCTGGCTGTGCATCAGAATCAGG + Intergenic
1092527098 12:9315941-9315963 GGTCCCAGGGCATCACACTCAGG - Intergenic
1092540171 12:9415831-9415853 GGTCCCAGGGCATCACACTCAGG + Intergenic
1094512869 12:31106625-31106647 GGTCCTAGGGCATCACACTCAGG - Intergenic
1095726877 12:45463593-45463615 GGTCCTACTGCATCACAATTGGG + Intergenic
1097200942 12:57278067-57278089 GCTTCCAGGGCATCAAAACCTGG + Intronic
1113212003 13:107994271-107994293 TCTCCCAGTACATCACACTGGGG + Intergenic
1113767373 13:112889677-112889699 ACTCCCAGTGCCTCAGAATGTGG - Intergenic
1118633915 14:67730346-67730368 ACTTACAGTGCATCTCAATCTGG - Intronic
1120011773 14:79423667-79423689 GCTCTCATCGCCTCACAATCAGG + Intronic
1121971973 14:98366718-98366740 GGTCCCTGTGCATCACAATGAGG + Intergenic
1123707710 15:22962299-22962321 GCTCACTGTGGATCACAAGCAGG - Intronic
1127937798 15:63659792-63659814 GCTCCCAGTGGATCGCTGTCAGG + Exonic
1131087265 15:89587566-89587588 GCTTCCAGGGTACCACAATCTGG - Intronic
1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG + Intronic
1133570085 16:7032396-7032418 GATCCCAGTGCACTCCAATCTGG + Intronic
1139383927 16:66552019-66552041 GCCCCCAGGGCATCACACTCGGG - Intronic
1144791657 17:17862984-17863006 ACTCCCAGTGCACCACATGCCGG + Intronic
1145065418 17:19758330-19758352 TCTCCCAGTGCCTCCCAAACTGG + Intergenic
1154121505 18:11656107-11656129 GTTTCCAGTGCTCCACAATCTGG - Intergenic
1155079788 18:22397514-22397536 CCTCCCAGTGCATCACATAGCGG + Intergenic
1158132686 18:54170451-54170473 GTTCCCAGAGCATCAGAATAGGG - Intronic
1161284956 19:3464090-3464112 GCTGCCAGTGCCTTACATTCTGG + Intronic
1163700273 19:18783283-18783305 GCTCCCAGTGCAGCCCAGTCAGG - Intronic
1165348809 19:35265784-35265806 CCTGCCACTGCATCTCAATCTGG + Intronic
928868567 2:35947839-35947861 ACTCCCAGTGAATTACAATGTGG + Intergenic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
929988420 2:46761957-46761979 CCTCCCACTGCATCAGAAGCAGG + Exonic
933389535 2:81652593-81652615 GTTCCCAGTACATCAACATCAGG - Intergenic
939614981 2:144352260-144352282 GCTTCCAGTGGATTATAATCTGG + Intergenic
948771160 2:240251852-240251874 GCTCCCACTGCCTCCCCATCTGG + Intergenic
1172222520 20:33283598-33283620 ACTCCCAGTGCAGGACAATGTGG + Intronic
1173997969 20:47354002-47354024 GCTCCCAGAGCAGCCCAATGGGG - Intronic
1174074635 20:47924698-47924720 TCTCCCAGTGCGTCAACATCTGG - Intergenic
1179251460 21:39674580-39674602 GCTGCCAGTGCCTCACGCTCAGG + Intergenic
1180917220 22:19497606-19497628 GCTCCCAGGGCTTCACAGTTAGG - Intronic
1182555698 22:31127293-31127315 GCTCCCAGTGCCTCACCTCCTGG + Intronic
1183784753 22:40022899-40022921 GCTCTCACACCATCACAATCCGG - Intronic
1184477305 22:44728710-44728732 GCTCCCAGTGGAACCCAAGCAGG - Intronic
959373438 3:105558443-105558465 GCAGCCAGTAAATCACAATCTGG - Intronic
969087587 4:4667924-4667946 CCTTCCAGCGCATCAGAATCAGG + Intergenic
977219960 4:94327127-94327149 GGTACCAGTGCATCCCATTCAGG - Intronic
979682452 4:123476775-123476797 GCTCCCAGTACATCAGAATGTGG - Intergenic
984336662 4:178401183-178401205 ACCCCCAGTGCATCAGAATGTGG + Intergenic
986480829 5:8185557-8185579 GCTACCACTGAATCACAATGAGG - Intergenic
991473986 5:67000304-67000326 GCTCCCTGTGCAGGACACTCGGG - Intronic
995062985 5:107831584-107831606 ACTCTCAGTGCCTCACATTCAGG + Intergenic
1002214267 5:177618670-177618692 GCCTCCAGTGCATCAGAGTCTGG + Intergenic
1004441391 6:15658546-15658568 GAACCCAGTGCATCACAAATAGG + Intronic
1006847914 6:37075820-37075842 GCTCACAGCGCATCCCAATTTGG - Intergenic
1007048911 6:38805961-38805983 GCCCCAAGTGAACCACAATCTGG - Intronic
1010012816 6:71068964-71068986 GGTCCCAGTGCACCAAAGTCAGG - Intergenic
1010323932 6:74543733-74543755 GCTGGCAGTGCATCAGAATCAGG - Intergenic
1010825041 6:80462889-80462911 GCTCCCAGTGCATCACAATCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1036760062 8:11502690-11502712 GCCCCCAGTGCATCACTGACGGG + Intronic
1039192097 8:34987689-34987711 ACTCTCAGTGCATCACAGTAGGG + Intergenic
1039477030 8:37844472-37844494 GCTCCCAGTGGATATCCATCAGG + Exonic
1039829607 8:41202363-41202385 CCTCCCAGGGCATCACAAAGAGG + Intergenic
1039846681 8:41330445-41330467 GCTGGCAGAGCACCACAATCAGG - Intergenic
1041148931 8:54911603-54911625 GCTACCAGTGCATTACTAACTGG - Intergenic
1049738168 8:144221136-144221158 GGTCACAGAGCATCACAACCAGG + Intronic
1050310564 9:4348664-4348686 TCTCCCAGTGACTCACAATATGG + Intergenic
1057561184 9:96129162-96129184 CCTCCCACTGCATCACAAGCTGG - Intergenic
1058026819 9:100149965-100149987 TCTCCCAGTGCAGCAGTATCAGG - Intronic
1060587458 9:124795411-124795433 GCCCCCAGTGCACCAAGATCAGG + Intronic
1062550504 9:137083937-137083959 CCTCCCAGTGCCTCTAAATCTGG - Exonic
1186098887 X:6133662-6133684 GCTTCCAGTGACTCAAAATCTGG - Intronic
1186750300 X:12614692-12614714 GCTCACAGTGAATCATGATCAGG + Intronic
1188535616 X:31193740-31193762 CCTACCACTGTATCACAATCTGG - Intronic
1192682788 X:73268866-73268888 GCTCCCAGTTAATCACACTGAGG - Intergenic