ID: 1010829080

View in Genome Browser
Species Human (GRCh38)
Location 6:80508965-80508987
Sequence TAGCCCTTAACAATAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010829080_1010829084 20 Left 1010829080 6:80508965-80508987 CCTGCAGTTATTGTTAAGGGCTA No data
Right 1010829084 6:80509008-80509030 TCTCAGCCATTTGTGTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010829080 Original CRISPR TAGCCCTTAACAATAACTGC AGG (reversed) Intergenic
No off target data available for this crispr