ID: 1010833457

View in Genome Browser
Species Human (GRCh38)
Location 6:80557878-80557900
Sequence GGGGAGAAAAAGAGTTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010833457_1010833468 21 Left 1010833457 6:80557878-80557900 CCCTCCCAACTCTTTTTCTCCCC No data
Right 1010833468 6:80557922-80557944 AATTCTTTTCTGGATTACTCTGG No data
1010833457_1010833467 11 Left 1010833457 6:80557878-80557900 CCCTCCCAACTCTTTTTCTCCCC No data
Right 1010833467 6:80557912-80557934 GTTCATTTCTAATTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010833457 Original CRISPR GGGGAGAAAAAGAGTTGGGA GGG (reversed) Intergenic
No off target data available for this crispr