ID: 1010837824

View in Genome Browser
Species Human (GRCh38)
Location 6:80612061-80612083
Sequence CTCAATTTTGAACCACTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010837824_1010837825 1 Left 1010837824 6:80612061-80612083 CCTGAGAGTGGTTCAAAATTGAG No data
Right 1010837825 6:80612085-80612107 CTTCCAACTTCAAAATGACCAGG No data
1010837824_1010837828 23 Left 1010837824 6:80612061-80612083 CCTGAGAGTGGTTCAAAATTGAG No data
Right 1010837828 6:80612107-80612129 GAAGCTTTCAGAGCCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010837824 Original CRISPR CTCAATTTTGAACCACTCTC AGG (reversed) Intergenic