ID: 1010837826

View in Genome Browser
Species Human (GRCh38)
Location 6:80612088-80612110
Sequence CTTCCTGGTCATTTTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010837826_1010837830 14 Left 1010837826 6:80612088-80612110 CCAACTTCAAAATGACCAGGAAG No data
Right 1010837830 6:80612125-80612147 TGAGGAACAGAAGAGTCCCCAGG No data
1010837826_1010837828 -4 Left 1010837826 6:80612088-80612110 CCAACTTCAAAATGACCAGGAAG No data
Right 1010837828 6:80612107-80612129 GAAGCTTTCAGAGCCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010837826 Original CRISPR CTTCCTGGTCATTTTGAAGT TGG (reversed) Intergenic