ID: 1010838976

View in Genome Browser
Species Human (GRCh38)
Location 6:80624645-80624667
Sequence CTCTGGACACACTTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010838971_1010838976 24 Left 1010838971 6:80624598-80624620 CCTCTTAATAGCAGAACTGGTCA No data
Right 1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010838976 Original CRISPR CTCTGGACACACTTGGGGCC TGG Intergenic
No off target data available for this crispr