ID: 1010840360

View in Genome Browser
Species Human (GRCh38)
Location 6:80642403-80642425
Sequence GAGAATAATCCTAATGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010840354_1010840360 9 Left 1010840354 6:80642371-80642393 CCTTCCTTTTGATCTCACTAGGA No data
Right 1010840360 6:80642403-80642425 GAGAATAATCCTAATGGGGTTGG No data
1010840352_1010840360 28 Left 1010840352 6:80642352-80642374 CCACTTCAGAGCTAGGTTACCTT No data
Right 1010840360 6:80642403-80642425 GAGAATAATCCTAATGGGGTTGG No data
1010840355_1010840360 5 Left 1010840355 6:80642375-80642397 CCTTTTGATCTCACTAGGAAAGT No data
Right 1010840360 6:80642403-80642425 GAGAATAATCCTAATGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010840360 Original CRISPR GAGAATAATCCTAATGGGGT TGG Intergenic
No off target data available for this crispr