ID: 1010841093

View in Genome Browser
Species Human (GRCh38)
Location 6:80649921-80649943
Sequence GAATTCTTACACAAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010841093_1010841094 0 Left 1010841093 6:80649921-80649943 CCTGGGCTCTTGTGTAAGAATTC No data
Right 1010841094 6:80649944-80649966 TGACTGCACTAACCATGCCTAGG 0: 69
1: 153
2: 186
3: 104
4: 129
1010841093_1010841095 4 Left 1010841093 6:80649921-80649943 CCTGGGCTCTTGTGTAAGAATTC No data
Right 1010841095 6:80649948-80649970 TGCACTAACCATGCCTAGGAAGG No data
1010841093_1010841099 29 Left 1010841093 6:80649921-80649943 CCTGGGCTCTTGTGTAAGAATTC No data
Right 1010841099 6:80649973-80649995 AGGAGTTGTTATTTTGTAGAAGG No data
1010841093_1010841096 9 Left 1010841093 6:80649921-80649943 CCTGGGCTCTTGTGTAAGAATTC No data
Right 1010841096 6:80649953-80649975 TAACCATGCCTAGGAAGGAAAGG 0: 458
1: 228
2: 137
3: 65
4: 165
1010841093_1010841100 30 Left 1010841093 6:80649921-80649943 CCTGGGCTCTTGTGTAAGAATTC No data
Right 1010841100 6:80649974-80649996 GGAGTTGTTATTTTGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010841093 Original CRISPR GAATTCTTACACAAGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr