ID: 1010842288

View in Genome Browser
Species Human (GRCh38)
Location 6:80660480-80660502
Sequence GCACACTCACAAACCAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010842288_1010842289 6 Left 1010842288 6:80660480-80660502 CCTGTATTGGTTTGTGAGTGTGC No data
Right 1010842289 6:80660509-80660531 ACCTTTTTGTTTTGTAGAGATGG No data
1010842288_1010842291 7 Left 1010842288 6:80660480-80660502 CCTGTATTGGTTTGTGAGTGTGC No data
Right 1010842291 6:80660510-80660532 CCTTTTTGTTTTGTAGAGATGGG No data
1010842288_1010842293 27 Left 1010842288 6:80660480-80660502 CCTGTATTGGTTTGTGAGTGTGC No data
Right 1010842293 6:80660530-80660552 GGGGTCTTGCTATGTTGTCCAGG 0: 237
1: 3300
2: 13803
3: 56808
4: 139847
1010842288_1010842292 8 Left 1010842288 6:80660480-80660502 CCTGTATTGGTTTGTGAGTGTGC No data
Right 1010842292 6:80660511-80660533 CTTTTTGTTTTGTAGAGATGGGG 0: 5
1: 86
2: 2319
3: 12064
4: 42156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010842288 Original CRISPR GCACACTCACAAACCAATAC AGG (reversed) Intergenic
No off target data available for this crispr