ID: 1010843628

View in Genome Browser
Species Human (GRCh38)
Location 6:80678324-80678346
Sequence CTGGACTCAACTGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010843628_1010843635 -4 Left 1010843628 6:80678324-80678346 CCTACAAAGGCAGTTGAGTCCAG No data
Right 1010843635 6:80678343-80678365 CCAGGGTTTGTTTTGGGAAAGGG No data
1010843628_1010843633 -5 Left 1010843628 6:80678324-80678346 CCTACAAAGGCAGTTGAGTCCAG No data
Right 1010843633 6:80678342-80678364 TCCAGGGTTTGTTTTGGGAAAGG No data
1010843628_1010843632 -10 Left 1010843628 6:80678324-80678346 CCTACAAAGGCAGTTGAGTCCAG No data
Right 1010843632 6:80678337-80678359 TTGAGTCCAGGGTTTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010843628 Original CRISPR CTGGACTCAACTGCCTTTGT AGG (reversed) Intergenic
No off target data available for this crispr