ID: 1010862780

View in Genome Browser
Species Human (GRCh38)
Location 6:80934284-80934306
Sequence CTGGTTTCACAGATTGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010862776_1010862780 6 Left 1010862776 6:80934255-80934277 CCTTTCCTGGTTTTGGTATTAGG 0: 440
1: 647
2: 490
3: 639
4: 898
Right 1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG No data
1010862778_1010862780 1 Left 1010862778 6:80934260-80934282 CCTGGTTTTGGTATTAGGATGAT 0: 110
1: 2618
2: 8602
3: 6494
4: 2442
Right 1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010862780 Original CRISPR CTGGTTTCACAGATTGATTT AGG Intergenic
No off target data available for this crispr