ID: 1010863055

View in Genome Browser
Species Human (GRCh38)
Location 6:80937519-80937541
Sequence CTGTGTCACCCCAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010863044_1010863055 18 Left 1010863044 6:80937478-80937500 CCAATGGAGTTATGTTCCCAGGG 0: 75
1: 144
2: 165
3: 121
4: 172
Right 1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG No data
1010863049_1010863055 2 Left 1010863049 6:80937494-80937516 CCCAGGGGGATTATGGCTGCCTC 0: 98
1: 360
2: 380
3: 237
4: 247
Right 1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG No data
1010863050_1010863055 1 Left 1010863050 6:80937495-80937517 CCAGGGGGATTATGGCTGCCTCT 0: 96
1: 192
2: 193
3: 115
4: 182
Right 1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010863055 Original CRISPR CTGTGTCACCCCAGGGAAGT GGG Intergenic
No off target data available for this crispr