ID: 1010865951

View in Genome Browser
Species Human (GRCh38)
Location 6:80976973-80976995
Sequence GGTCAATGCAAATTGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010865951_1010865955 -8 Left 1010865951 6:80976973-80976995 CCTCCCCTCAATTTGCATTGACC No data
Right 1010865955 6:80976988-80977010 CATTGACCTGCCCTTTACTATGG No data
1010865951_1010865959 8 Left 1010865951 6:80976973-80976995 CCTCCCCTCAATTTGCATTGACC No data
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010865951 Original CRISPR GGTCAATGCAAATTGAGGGG AGG (reversed) Intergenic