ID: 1010865952

View in Genome Browser
Species Human (GRCh38)
Location 6:80976976-80976998
Sequence GCAGGTCAATGCAAATTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010865952_1010865959 5 Left 1010865952 6:80976976-80976998 CCCCTCAATTTGCATTGACCTGC No data
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010865952 Original CRISPR GCAGGTCAATGCAAATTGAG GGG (reversed) Intergenic