ID: 1010865952

View in Genome Browser
Species Human (GRCh38)
Location 6:80976976-80976998
Sequence GCAGGTCAATGCAAATTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 3, 1: 4, 2: 17, 3: 41, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010865952_1010865959 5 Left 1010865952 6:80976976-80976998 CCCCTCAATTTGCATTGACCTGC 0: 3
1: 4
2: 17
3: 41
4: 139
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010865952 Original CRISPR GCAGGTCAATGCAAATTGAG GGG (reversed) Intergenic
900689250 1:3970126-3970148 GCAGTTCAGTGCACATTGATGGG - Intergenic
902260115 1:15218832-15218854 GTGGGTTAATGCAAATTGAGGGG - Intronic
905764937 1:40592497-40592519 GTGGGTTAATGCAAATTGAGGGG - Intergenic
906499872 1:46333818-46333840 GCAGGCTAATGCAAATTGAGGGG - Intergenic
908961991 1:69709224-69709246 ACAGTTCAGTGCAGATTGAGAGG + Intronic
909873290 1:80771853-80771875 GCAAGTGAATGTAAATAGAGAGG + Intergenic
910099237 1:83558983-83559005 GCTGGGCATTCCAAATTGAGGGG + Intergenic
912176636 1:107166120-107166142 GCAGTTCATTGCAAACTCAGAGG + Intronic
915696340 1:157746537-157746559 GCAGTTCAATGAATATTGATAGG + Exonic
915812013 1:158923133-158923155 GTAGGTGACTGCAAAGTGAGGGG + Intergenic
917633704 1:176915578-176915600 GCAGGTGAATGCCAATAGATTGG - Intronic
920624144 1:207579623-207579645 GTGGATCAATGCAGATTGAGGGG - Intronic
920636739 1:207711582-207711604 GCACATCAATGCAAATTGAGGGG - Intronic
921802407 1:219416617-219416639 GTTGATCAATGCAAATTGAGGGG + Intergenic
922968605 1:229715313-229715335 ACAGGTTAATGCAAATTGAGGGG - Intergenic
924823954 1:247521208-247521230 GCAGGTATATAAAAATTGAGTGG - Intronic
1063533851 10:6863443-6863465 GTTAGTTAATGCAAATTGAGAGG + Intergenic
1063925785 10:10975948-10975970 GTGGGTCAATGGAAATTGAGGGG + Intergenic
1064112033 10:12547898-12547920 GCGGGTCAATGCACATTGTTTGG + Intronic
1064461713 10:15541012-15541034 GTGGGTGAATGCAAATTGAAGGG - Intronic
1064647353 10:17473101-17473123 TCAGTTACATGCAAATTGAGGGG - Intergenic
1064710901 10:18123419-18123441 GTGGGTTAATGCAAATGGAGGGG - Intergenic
1064800471 10:19064956-19064978 GCAGATTAATGCAAATTGAGGGG + Intronic
1066580124 10:36871371-36871393 GCAGAGCAATGCAATTTGAAAGG + Intergenic
1067158451 10:43802343-43802365 GCAGGACAGGGAAAATTGAGTGG - Intergenic
1071078917 10:81785819-81785841 GCAGGGCACTGAAAATAGAGTGG + Intergenic
1071294697 10:84211230-84211252 GAAGGTCATTGCAGTTTGAGTGG + Intronic
1072631951 10:97152284-97152306 GAAGGTCCCTGCAAATTGAGGGG + Intronic
1073361108 10:102899577-102899599 TCTGGTCACTGCAAATAGAGGGG - Intronic
1073989151 10:109243437-109243459 GGAGTTCAATGCATATTAAGTGG - Intergenic
1077983114 11:7321764-7321786 GCGGGTTAATGCAAATAGAGGGG + Intronic
1078002570 11:7509774-7509796 CCAGGTCAATGTAAGTTGAGGGG - Exonic
1078999940 11:16743529-16743551 GAAGGTGAATGCAAAATGAAAGG - Intronic
1079841535 11:25406977-25406999 GCACTTCAATGTAATTTGAGAGG + Intergenic
1080438199 11:32265679-32265701 GCATTTGAATGCAAATTGAAGGG + Intergenic
1080678805 11:34453878-34453900 GCTGGTTAATGCAAATGGGGAGG + Exonic
1082898510 11:58219528-58219550 GCTGGTTAATACAAATTGAGAGG - Intergenic
1083274915 11:61591388-61591410 GGAGGTCGATGCAAGTTGGGAGG - Intergenic
1083915723 11:65742397-65742419 GTGAGTCAATTCAAATTGAGGGG + Intergenic
1086553959 11:88087656-88087678 GTATGTCAATGCAAATTGAGAGG + Intergenic
1086554426 11:88091928-88091950 GCACGTCAATGGAAATTGAGGGG + Intergenic
1087617146 11:100500280-100500302 GGAGATAAATGCAATTTGAGAGG + Intergenic
1088380198 11:109184370-109184392 GTGGGTCAATGGAAATTGATGGG + Intergenic
1092554212 12:9539225-9539247 GCAGGACAATCCAAACTAAGGGG + Intergenic
1094475961 12:30840746-30840768 ATGGGTCAATGCAAATTGAGGGG + Intergenic
1094517888 12:31151413-31151435 GCAGGACAATCCAAACTAAGGGG - Intergenic
1099839134 12:87943974-87943996 GCAAGCTAATGCAAATTGATGGG + Intergenic
1103879008 12:124151695-124151717 GCAGGTTAATGCAAATTGAGGGG + Intronic
1103975091 12:124697219-124697241 GAAGGACATTGCAAATGGAGTGG - Intergenic
1103979257 12:124725938-124725960 GCAAGTCAGTGCAAATTAAATGG + Intergenic
1104355395 12:128080668-128080690 GCAGGCCAATTCAAAGTGGGAGG - Intergenic
1107202065 13:37733376-37733398 AGAGATAAATGCAAATTGAGAGG - Intronic
1108376818 13:49821747-49821769 GAGGGTTAATGCAAATTGAGGGG - Intergenic
1109256965 13:60095432-60095454 GTGGGTCAATGTAAATTAAGGGG + Intronic
1110497053 13:76180348-76180370 GCAGATTAATGCAAATTGAGGGG - Intergenic
1111179601 13:84645783-84645805 GTGGATCAATGCAAATTGAGGGG + Intergenic
1113791307 13:113029875-113029897 ACATGTCAATGCAAATTAAATGG + Intronic
1116919201 14:50555053-50555075 GTAGGTCAATGGTATTTGAGTGG + Intronic
1117020456 14:51565225-51565247 TCAGAACAATGCAAATTGAATGG + Intronic
1117992674 14:61449952-61449974 GCAGATGAATGCAATATGAGTGG - Intronic
1118463374 14:66007855-66007877 ACAGGTCAATTCAGATAGAGAGG - Intergenic
1120441339 14:84544694-84544716 CCATGTCAATGCAAATTCAGAGG + Intergenic
1121330692 14:93047716-93047738 ACAGGTCACTGCAAACTGCGTGG - Intronic
1121513995 14:94536845-94536867 GCAGTTTAGTGCAAATTGAGGGG + Intergenic
1126171325 15:45697626-45697648 TCAGGTCAATCAAAATTGACTGG + Intergenic
1128070064 15:64789962-64789984 GCAGCTCAGTGCACACTGAGGGG - Intergenic
1128975157 15:72146828-72146850 GCTGATAAATGCAAAGTGAGAGG - Intergenic
1131645952 15:94344215-94344237 GCTGGTCAATGCAATGTAAGTGG + Intronic
1133475237 16:6114970-6114992 ACAAGTTAATGCAAACTGAGGGG + Intronic
1138777436 16:59740916-59740938 GAAGGTTAATGCAAATTGAGGGG + Intronic
1139020028 16:62737329-62737351 TCAGGTCAAACCAATTTGAGGGG + Intergenic
1140132698 16:72177872-72177894 TCAGGCAAATTCAAATTGAGGGG - Intergenic
1140614158 16:76639978-76640000 GTGAGTCAATGCAAATTGATGGG + Intergenic
1141329527 16:83096635-83096657 GTGTGTCAATGCAAAGTGAGCGG + Intronic
1144303058 17:13941312-13941334 GTGAGTCAATGCAAATTGAGGGG + Intergenic
1146087971 17:29847874-29847896 GCAGGTTAATGCAAATTGAGGGG - Intronic
1147253312 17:39166303-39166325 CCAGGGGAATGCAATTTGAGTGG - Intronic
1147536928 17:41327502-41327524 GCAGGACAATGGAAAGTGGGAGG - Intergenic
1150995419 17:70311750-70311772 ACAGGTCAATAAAAATTGATAGG - Intergenic
1152444193 17:80331171-80331193 GCAGGTCACTGCAGACTGGGAGG - Intronic
1155523943 18:26697563-26697585 GTGGGTCAATGCAATTTGAGGGG + Intergenic
1156400902 18:36739224-36739246 CCAGGTCAACACAAATTGAGGGG - Intronic
1159184451 18:64950447-64950469 GTAGGTTAATGCCAATTAAGGGG + Intergenic
1159246990 18:65819230-65819252 GTGGGTCAATGCAGATTGAGGGG - Intronic
1159337060 18:67081954-67081976 GTGAGCCAATGCAAATTGAGGGG - Intergenic
1159337070 18:67082027-67082049 GTGAGCCAATGCAAATTGAGGGG - Intergenic
1161844179 19:6702405-6702427 GCAGGTGCATGCAAATTAAACGG + Intronic
1165134736 19:33660701-33660723 GCAGGTTAATGCAAATCAAGGGG - Intronic
1165881366 19:39046330-39046352 GTGGGTTAATGCAAATTGAGAGG - Intergenic
1166652591 19:44585764-44585786 GTAGGTCAATGCAAATCGAGAGG + Intergenic
1167677897 19:50899715-50899737 ATGGGTCAATGTAAATTGAGGGG + Intergenic
925904035 2:8528645-8528667 GCAGGTGAATACACATCGAGTGG - Intergenic
930863707 2:56102495-56102517 GTGGGCCAATGCAAATTGAGGGG - Intergenic
932373309 2:71211294-71211316 GAAGGTCTATTCTAATTGAGCGG + Intronic
933486886 2:82935443-82935465 GTGGGTCAATGCAAATTGAGGGG - Intergenic
935056790 2:99574493-99574515 GCAGGTGAATGTAAATTAATGGG - Intronic
937803687 2:126111930-126111952 GGAGGTAAATACAAATTGAAAGG - Intergenic
938695027 2:133827242-133827264 GCAGGTCAAAGAAAACAGAGAGG + Intergenic
939206592 2:139113218-139113240 TCAGCTCAATGCAAAATAAGCGG - Intergenic
942233849 2:173885215-173885237 GCACAGCAATGCTAATTGAGGGG - Intergenic
945543619 2:211121366-211121388 GGAGGTGAATGGAGATTGAGGGG + Intergenic
946325743 2:218984014-218984036 GCAGGCCAAGGCAGATGGAGAGG - Intronic
947294147 2:228612403-228612425 GTAGGTAAAGGCAAATTGAGAGG - Intergenic
947469243 2:230385340-230385362 GCAGGTCAATGCACATGTTGAGG + Intronic
1168769600 20:407205-407227 GCAGGTCAATGGGACTTGAGTGG + Intergenic
1170478790 20:16744450-16744472 GAGGCTCAATACAAATTGAGGGG + Intergenic
1170498449 20:16949800-16949822 GCAGGTGATTGCAAGTTCAGTGG + Intergenic
1171325013 20:24283462-24283484 GCAGGTCAATACAAATTAAGGGG + Intergenic
1172570710 20:35968168-35968190 GCAGGCTAATGCAAATTAAGGGG + Intronic
1173150836 20:40565427-40565449 GCAGGGGAATGCAAAGTGAGGGG + Intergenic
1173308101 20:41871168-41871190 ACAGGTCAATGCAAATTGAGGGG - Intergenic
1173891976 20:46519780-46519802 GTGGATCAATGCAAATTGAGGGG - Intergenic
1175569398 20:60007555-60007577 GCAGGTTGATGCAAACGGAGGGG + Intronic
1177355759 21:20004700-20004722 ATGAGTCAATGCAAATTGAGGGG - Intergenic
1178042338 21:28653001-28653023 GAGGGTTAATGCAAATTGAGGGG - Intergenic
1185242913 22:49755979-49756001 ATGGGCCAATGCAAATTGAGGGG - Intergenic
949263976 3:2135661-2135683 GCTGGTCAATGCAGATGAAGGGG + Intronic
953110475 3:39932669-39932691 CCAGGTCAATGAACATTGAAAGG - Intronic
956907178 3:73778383-73778405 GCAGGAGAAAGCAAACTGAGTGG - Intergenic
959171775 3:102852821-102852843 ACAGGTTGATGCAAATTAAGGGG + Intergenic
962535825 3:136327972-136327994 GCAGGTGAAAGGAAAGTGAGAGG + Intronic
964197302 3:154079546-154079568 GCAGGTTAGTGCAATTTGAGAGG + Intergenic
964515659 3:157504931-157504953 GCAGCTCATTGAAAATTAAGTGG + Intronic
966218044 3:177522478-177522500 GCAGGTCAATCGATATTGAAAGG - Intergenic
971331928 4:25688807-25688829 GCAGGTCATCACAAAGTGAGGGG - Intergenic
972817888 4:42664840-42664862 GCAGGATATTGGAAATTGAGTGG + Intergenic
976076385 4:81303756-81303778 GCAGATCATTGCAAATTCATAGG - Intergenic
976188510 4:82467068-82467090 GCAAGGTACTGCAAATTGAGTGG + Intergenic
977825271 4:101523919-101523941 GTAGGTCAATGTAAATTGAGAGG - Intronic
981338974 4:143598358-143598380 TCAGCTCAGTGCAAAGTGAGTGG - Intronic
983002267 4:162431307-162431329 GCAGGGCAGTGCCACTTGAGGGG - Intergenic
985700463 5:1368838-1368860 ACAGGTCAATGCAAATTAAGGGG - Intergenic
985701431 5:1375485-1375507 AGAGATCAATGCAAATTGAGGGG - Intergenic
986866003 5:11987986-11988008 GCAGACAAATCCAAATTGAGGGG + Intergenic
986949518 5:13065857-13065879 GCAGGACAATTCAAAGTGTGGGG + Intergenic
989311326 5:40022123-40022145 GCATGTCAATGCAAATTTAGGGG + Intergenic
990530641 5:56669993-56670015 GCAGGACAATGCTAAAGGAGGGG - Intergenic
992974635 5:82101524-82101546 GGAGGACAATGGATATTGAGAGG + Intronic
993045296 5:82859560-82859582 GAAGTTCAATGCTAATAGAGAGG - Intergenic
994772556 5:104002013-104002035 ACATGTTACTGCAAATTGAGGGG + Intergenic
995953883 5:117750958-117750980 GCAGGTGAAAGAATATTGAGTGG - Intergenic
996867737 5:128146479-128146501 TCAGGTGAATTCAAACTGAGAGG - Intronic
997065444 5:130554184-130554206 GTGGGTCAATGCAAATTGAGGGG - Intergenic
998847480 5:146325072-146325094 GCAGGTGAATCCAGATTGAGGGG - Intronic
999802851 5:155053768-155053790 GAAGGTCACAGCAAATTTAGTGG + Intergenic
1003043806 6:2714334-2714356 GTGAGTTAATGCAAATTGAGGGG - Intronic
1003085303 6:3055683-3055705 GCAGGTGACTGCCAAATGAGGGG - Intergenic
1003810273 6:9771983-9772005 CCAATGCAATGCAAATTGAGAGG + Intronic
1005137404 6:22585674-22585696 GGAGGTCTATGTATATTGAGGGG + Intergenic
1005886279 6:30100390-30100412 GCTGGTCCACGAAAATTGAGTGG + Intergenic
1007155065 6:39734547-39734569 GCAGATCATTGCAACTTTAGTGG - Intergenic
1008206919 6:48671568-48671590 GCAGGTTAATGCAACTTAAAGGG + Intergenic
1009370478 6:62894378-62894400 GTGGATTAATGCAAATTGAGGGG + Intergenic
1010476031 6:76288515-76288537 GCAGTTCATTGCAAAGTTAGTGG - Intergenic
1010616603 6:78020564-78020586 GCAGGTTAATATGAATTGAGGGG - Intergenic
1010865952 6:80976976-80976998 GCAGGTCAATGCAAATTGAGGGG - Intergenic
1010866604 6:80983335-80983357 GAAGGTCAATGCAAATTGAGGGG - Intergenic
1010986024 6:82425331-82425353 GCAGGTCTATCCAAATGGTGGGG - Intergenic
1011996248 6:93592616-93592638 GAAGGTGCATGCAAATTCAGTGG - Intergenic
1012227321 6:96718939-96718961 GCAGGCCACTGAAAATTCAGGGG + Intergenic
1015910992 6:138167537-138167559 TCAGGTCAATGCAACTGGACAGG - Intronic
1016073283 6:139766555-139766577 TCAGGTTAATGCACATTGAGTGG - Intergenic
1016128641 6:140437427-140437449 ACAGACCAATGCAAATTAAGAGG - Intergenic
1018415616 6:163599996-163600018 GCGGGTCAATGTAAAGTGAGGGG - Intergenic
1018623258 6:165751800-165751822 ACAGGTGCATGCAAATTGAGGGG - Intronic
1019029092 6:168995048-168995070 GCGGGCCAATGCCAATGGAGGGG + Intergenic
1019954339 7:4401435-4401457 GTAGGTCAATGCAAGCTGAGGGG + Intergenic
1022475588 7:30707534-30707556 GCAGGTCAATAAAAGGTGAGTGG + Intronic
1023381583 7:39613398-39613420 GCAAATTAATGCAAATTTAGTGG - Intergenic
1024104827 7:46072293-46072315 TCAAGTCCATGAAAATTGAGGGG + Intergenic
1024747669 7:52427159-52427181 GTGGGTTAATGCAAATTGAGGGG - Intergenic
1026700051 7:72633170-72633192 GCAGGCCAATGCAAATAAAGGGG - Intronic
1030542583 7:110850415-110850437 GCAGGTCAATGCAAATTGAGAGG - Intronic
1035138298 7:156729931-156729953 TCAAGACAATGAAAATTGAGGGG + Intronic
1039137940 8:34347947-34347969 TCAGATCAATGAAAACTGAGAGG - Intergenic
1039157652 8:34579689-34579711 GCAGATCAATGTAAATTGAGGGG - Intergenic
1039258811 8:35748598-35748620 GATGGTCAATGCAAAGGGAGTGG - Exonic
1039725038 8:40206394-40206416 GCAGGTTAATGCAAATTGCAGGG + Intergenic
1047218580 8:122899802-122899824 GCAGTTTAATGCAAATTGGAGGG + Intronic
1049493869 8:142919789-142919811 TCAGGTAAATAAAAATTGAGGGG - Intergenic
1051011162 9:12416233-12416255 GCGAGTCAAAGCAAATTAAGGGG + Intergenic
1052247985 9:26361546-26361568 ATAAGTCAATGCAAATTGACAGG - Intergenic
1055079496 9:72255228-72255250 GTGGGTGGATGCAAATTGAGGGG + Intronic
1055464731 9:76553275-76553297 TCAATTCACTGCAAATTGAGAGG - Intergenic
1057818348 9:98312357-98312379 TCAGGCTAATCCAAATTGAGGGG - Intronic
1057875196 9:98748216-98748238 GAAGGTCAGTGCAGATGGAGAGG - Intronic
1058310620 9:103497058-103497080 TCAGGCCAATGCAAATCAAGGGG + Intergenic
1059499750 9:114741484-114741506 CCAGGTCACTGCAAATGCAGTGG - Intergenic
1060086581 9:120708728-120708750 GCAGGTAAATGCAAATAAACTGG + Intronic
1188020644 X:25153275-25153297 ACAGGGCACTGAAAATTGAGTGG + Intergenic
1188187650 X:27134673-27134695 GTGGGTCAATGCAAATTGTGCGG - Intergenic
1190364638 X:49680110-49680132 GTCAGTCAATGCAAATTGAGGGG + Intergenic
1190554769 X:51623083-51623105 GCAGGTCAATGCAAATTGAGGGG + Intergenic
1190628397 X:52359928-52359950 GCGGGTTAATGCAAATTTAGGGG - Intergenic
1190628664 X:52363568-52363590 TCAGTTTAACGCAAATTGAGGGG - Intergenic
1190682075 X:52835000-52835022 GTAGGTTAATGCAAATTGAAGGG + Intergenic
1190953317 X:55167453-55167475 GCAGGTTAATGCAAGTTGAGGGG - Intronic
1190999000 X:55639146-55639168 GTGGGTTAATGCAAATTGAAGGG + Intergenic
1195220843 X:102744783-102744805 GCAGATCAATGCTAATTCATAGG - Intronic
1195268834 X:103211339-103211361 GTGGGTTAATGCAAATTGAAGGG - Intergenic
1195373933 X:104207067-104207089 GTGGGTTAATGCAAATTGAGGGG + Intergenic
1197116790 X:122843252-122843274 GAATGTCAGTGCAAATGGAGAGG - Intergenic
1198618372 X:138481767-138481789 TCAGGTCAGTGGAAAATGAGGGG - Intergenic
1200073177 X:153538874-153538896 GCAGGTCAAGGCCAAGGGAGAGG + Intronic