ID: 1010865959

View in Genome Browser
Species Human (GRCh38)
Location 6:80977004-80977026
Sequence ACTATGGATGTACTTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010865954_1010865959 3 Left 1010865954 6:80976978-80977000 CCTCAATTTGCATTGACCTGCCC No data
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data
1010865951_1010865959 8 Left 1010865951 6:80976973-80976995 CCTCCCCTCAATTTGCATTGACC No data
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data
1010865952_1010865959 5 Left 1010865952 6:80976976-80976998 CCCCTCAATTTGCATTGACCTGC 0: 3
1: 4
2: 17
3: 41
4: 139
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data
1010865950_1010865959 28 Left 1010865950 6:80976953-80976975 CCTAGAAAGTTCTAAATAATCCT No data
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data
1010865953_1010865959 4 Left 1010865953 6:80976977-80976999 CCCTCAATTTGCATTGACCTGCC No data
Right 1010865959 6:80977004-80977026 ACTATGGATGTACTTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010865959 Original CRISPR ACTATGGATGTACTTGAAAG TGG Intergenic
No off target data available for this crispr