ID: 1010866606

View in Genome Browser
Species Human (GRCh38)
Location 6:80983337-80983359
Sequence GGGAAGGTCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010866606_1010866612 4 Left 1010866606 6:80983337-80983359 CCTCAATTTGCATTGACCTTCCC No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data
1010866606_1010866611 3 Left 1010866606 6:80983337-80983359 CCTCAATTTGCATTGACCTTCCC No data
Right 1010866611 6:80983363-80983385 ACTTTATATGTAATTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010866606 Original CRISPR GGGAAGGTCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr