ID: 1010866612

View in Genome Browser
Species Human (GRCh38)
Location 6:80983364-80983386
Sequence CTTTATATGTAATTAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010866601_1010866612 29 Left 1010866601 6:80983312-80983334 CCTAGAAAGTTCTAAATAACCCA No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data
1010866604_1010866612 6 Left 1010866604 6:80983335-80983357 CCCCTCAATTTGCATTGACCTTC No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data
1010866602_1010866612 10 Left 1010866602 6:80983331-80983353 CCCACCCCTCAATTTGCATTGAC No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data
1010866606_1010866612 4 Left 1010866606 6:80983337-80983359 CCTCAATTTGCATTGACCTTCCC No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data
1010866603_1010866612 9 Left 1010866603 6:80983332-80983354 CCACCCCTCAATTTGCATTGACC No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data
1010866605_1010866612 5 Left 1010866605 6:80983336-80983358 CCCTCAATTTGCATTGACCTTCC No data
Right 1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010866612 Original CRISPR CTTTATATGTAATTAAAAGT GGG Intergenic
No off target data available for this crispr