ID: 1010873009

View in Genome Browser
Species Human (GRCh38)
Location 6:81064665-81064687
Sequence TGGGATTCAATCTATCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010873009_1010873020 27 Left 1010873009 6:81064665-81064687 CCCACCTGATAGATTGAATCCCA No data
Right 1010873020 6:81064715-81064737 AGGCTCCTCACCCCTGCAAATGG No data
1010873009_1010873013 -9 Left 1010873009 6:81064665-81064687 CCCACCTGATAGATTGAATCCCA No data
Right 1010873013 6:81064679-81064701 TGAATCCCAGGTCACTATCCAGG No data
1010873009_1010873016 2 Left 1010873009 6:81064665-81064687 CCCACCTGATAGATTGAATCCCA No data
Right 1010873016 6:81064690-81064712 TCACTATCCAGGAAACGAAGAGG No data
1010873009_1010873017 7 Left 1010873009 6:81064665-81064687 CCCACCTGATAGATTGAATCCCA No data
Right 1010873017 6:81064695-81064717 ATCCAGGAAACGAAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010873009 Original CRISPR TGGGATTCAATCTATCAGGT GGG (reversed) Intergenic
No off target data available for this crispr