ID: 1010877913

View in Genome Browser
Species Human (GRCh38)
Location 6:81131217-81131239
Sequence CCACGTAGTCAGGTATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010877913_1010877919 11 Left 1010877913 6:81131217-81131239 CCTTGCAATACCTGACTACGTGG No data
Right 1010877919 6:81131251-81131273 AGCCCCACCTGCTAACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010877913 Original CRISPR CCACGTAGTCAGGTATTGCA AGG (reversed) Intergenic
No off target data available for this crispr