ID: 1010879845

View in Genome Browser
Species Human (GRCh38)
Location 6:81153847-81153869
Sequence CCTAGATTTTAGTAGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010879845_1010879852 22 Left 1010879845 6:81153847-81153869 CCATACACCTACTAAAATCTAGG No data
Right 1010879852 6:81153892-81153914 CTTGACTTCTGTGCACTCTCAGG 0: 16
1: 221
2: 888
3: 1443
4: 1449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010879845 Original CRISPR CCTAGATTTTAGTAGGTGTA TGG (reversed) Intergenic
No off target data available for this crispr