ID: 1010898480

View in Genome Browser
Species Human (GRCh38)
Location 6:81396126-81396148
Sequence CTGTTGTTTTGGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010898480_1010898485 12 Left 1010898480 6:81396126-81396148 CCTTATTCCCTCCAAAACAACAG No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010898480 Original CRISPR CTGTTGTTTTGGAGGGAATA AGG (reversed) Intergenic
No off target data available for this crispr