ID: 1010898485

View in Genome Browser
Species Human (GRCh38)
Location 6:81396161-81396183
Sequence CCCAGTAAATAATTCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010898477_1010898485 28 Left 1010898477 6:81396110-81396132 CCCACTACTCATGCCTCCTTATT No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data
1010898480_1010898485 12 Left 1010898480 6:81396126-81396148 CCTTATTCCCTCCAAAACAACAG No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data
1010898482_1010898485 4 Left 1010898482 6:81396134-81396156 CCTCCAAAACAACAGTATTGAAC No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data
1010898478_1010898485 27 Left 1010898478 6:81396111-81396133 CCACTACTCATGCCTCCTTATTC No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data
1010898481_1010898485 5 Left 1010898481 6:81396133-81396155 CCCTCCAAAACAACAGTATTGAA No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data
1010898483_1010898485 1 Left 1010898483 6:81396137-81396159 CCAAAACAACAGTATTGAACTTA No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data
1010898479_1010898485 15 Left 1010898479 6:81396123-81396145 CCTCCTTATTCCCTCCAAAACAA No data
Right 1010898485 6:81396161-81396183 CCCAGTAAATAATTCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010898485 Original CRISPR CCCAGTAAATAATTCTACCA TGG Intergenic
No off target data available for this crispr