ID: 1010898600

View in Genome Browser
Species Human (GRCh38)
Location 6:81398087-81398109
Sequence CTGTAAATACAGGCAAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010898600_1010898604 25 Left 1010898600 6:81398087-81398109 CCAAGATTTGCCTGTATTTACAG No data
Right 1010898604 6:81398135-81398157 TTACAAATTGTTTTCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010898600 Original CRISPR CTGTAAATACAGGCAAATCT TGG (reversed) Intergenic
No off target data available for this crispr