ID: 1010905885

View in Genome Browser
Species Human (GRCh38)
Location 6:81487688-81487710
Sequence TGCCCAGTGCAGCCTCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010905883_1010905885 -9 Left 1010905883 6:81487674-81487696 CCTTGTCAGCTCCATGCCCAGTG No data
Right 1010905885 6:81487688-81487710 TGCCCAGTGCAGCCTCTGATTGG No data
1010905880_1010905885 20 Left 1010905880 6:81487645-81487667 CCAAAGGCAGAGCAGCCAATGGT No data
Right 1010905885 6:81487688-81487710 TGCCCAGTGCAGCCTCTGATTGG No data
1010905882_1010905885 5 Left 1010905882 6:81487660-81487682 CCAATGGTGGAAAGCCTTGTCAG No data
Right 1010905885 6:81487688-81487710 TGCCCAGTGCAGCCTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010905885 Original CRISPR TGCCCAGTGCAGCCTCTGAT TGG Intergenic
No off target data available for this crispr