ID: 1010906986 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:81502808-81502830 |
| Sequence | TCTAATATTTAGTATCTGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3169 | |||
| Summary | {0: 1, 1: 4, 2: 64, 3: 587, 4: 2513} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010906984_1010906986 | 24 | Left | 1010906984 | 6:81502761-81502783 | CCTATAGAATGGCAGAAAATATT | 0: 7 1: 395 2: 4435 3: 16336 4: 18289 |
||
| Right | 1010906986 | 6:81502808-81502830 | TCTAATATTTAGTATCTGTAAGG | 0: 1 1: 4 2: 64 3: 587 4: 2513 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010906986 | Original CRISPR | TCTAATATTTAGTATCTGTA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||