ID: 1010906986

View in Genome Browser
Species Human (GRCh38)
Location 6:81502808-81502830
Sequence TCTAATATTTAGTATCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3169
Summary {0: 1, 1: 4, 2: 64, 3: 587, 4: 2513}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010906984_1010906986 24 Left 1010906984 6:81502761-81502783 CCTATAGAATGGCAGAAAATATT 0: 7
1: 395
2: 4435
3: 16336
4: 18289
Right 1010906986 6:81502808-81502830 TCTAATATTTAGTATCTGTAAGG 0: 1
1: 4
2: 64
3: 587
4: 2513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010906986 Original CRISPR TCTAATATTTAGTATCTGTA AGG Intronic
Too many off-targets to display for this crispr