ID: 1010911009

View in Genome Browser
Species Human (GRCh38)
Location 6:81556438-81556460
Sequence GTTCTAATGTGACCATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010911009 Original CRISPR GTTCTAATGTGACCATACCC TGG Intronic
911304007 1:96210931-96210953 CTTCTAATGGGACCATGCTCTGG + Intergenic
911672507 1:100622735-100622757 GTTCCAATATTACCCTACCCTGG - Intergenic
921746884 1:218750235-218750257 GTTCTAGTGTGTACATACTCTGG - Intergenic
1066400410 10:35070745-35070767 GCTCTAATGTCACCATCCTCAGG + Intronic
1071585217 10:86813686-86813708 GTTCTAATGGCAACATGCCCTGG - Intronic
1072978971 10:100083684-100083706 GTTCTATTGGGTACATACCCAGG - Intergenic
1085953527 11:81362989-81363011 GTTTTAGTGTGACCATCACCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1118437585 14:65785594-65785616 ATTCTAATGTGAACACACCCAGG - Intergenic
1119639195 14:76302016-76302038 GTTCAAATTTGACCATATCCTGG + Intergenic
1127841056 15:62832432-62832454 GGTCTAATCTGACCACCCCCCGG + Intronic
1130685079 15:86030272-86030294 GTTCGAATGTGACAATTGCCAGG - Intergenic
1132164206 15:99568805-99568827 GTTGTCATCAGACCATACCCCGG + Intronic
1134006905 16:10824089-10824111 GTCCTATTGTAACCATACACAGG + Intergenic
1134368284 16:13599568-13599590 GTTGTTATGTGACAATAACCCGG + Intergenic
1135209495 16:20512179-20512201 CTTCCAAGGTGACCATGCCCAGG + Intergenic
1142441204 16:90098605-90098627 TTTCAAATGTGAATATACCCAGG + Intergenic
1142510234 17:388367-388389 GTTCTAAAGTGAGCTGACCCTGG - Intergenic
1149076209 17:52598133-52598155 GTTCTAGTGTGTACATACTCTGG + Intergenic
1152842390 17:82578520-82578542 GTTGTAATTTGATCAAACCCAGG - Intronic
1152995601 18:403476-403498 GTGTTAGTGTGAGCATACCCAGG - Intronic
1153032744 18:730301-730323 GTTCTAATCTGCACATACACAGG - Intronic
1157142777 18:45127565-45127587 GTTCTATTGTGGCTATGCCCTGG + Intergenic
1161658364 19:5529985-5530007 GTTCTACTCTGCCCAGACCCTGG - Intergenic
1164481152 19:28611885-28611907 GTTCTAATGTGTACATACTCTGG + Intergenic
926523678 2:13949791-13949813 GTTTTAATGCGACTAGACCCAGG - Intergenic
927138676 2:20115151-20115173 GTTCAATTGCTACCATACCCTGG - Intergenic
931698296 2:64888601-64888623 GTTCTAGTGTGTACATACTCTGG - Intergenic
933640276 2:84751522-84751544 GTTCTAATGAGCCTATACCATGG - Intronic
943078276 2:183225021-183225043 AATCTAATGTGTCCTTACCCAGG - Intergenic
943176032 2:184475486-184475508 GTTCTAGTGAGACAATTCCCAGG + Intergenic
943507753 2:188783054-188783076 GTTCTAATATAACCATGCCCTGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945228635 2:207559635-207559657 GTTTTAATGAGTCAATACCCAGG - Intronic
948861274 2:240753762-240753784 GTTCTAATGTGCTGAGACCCTGG - Intronic
1170498012 20:16945739-16945761 TTTCTCATGTGAACATACCTAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
949158202 3:851774-851796 GTTCTAGTGTGTACATACTCTGG + Intergenic
953987579 3:47457151-47457173 CTTCTCATGTGTCCATTCCCAGG - Intronic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
957368136 3:79253337-79253359 GTGCTAAGGTAAACATACCCTGG + Intronic
968361466 3:198149577-198149599 TTTCAAATGTGAATATACCCAGG + Intergenic
969994590 4:11298950-11298972 CTTCTAATGTGTCAAGACCCAGG + Intergenic
970157068 4:13152324-13152346 GCTCAAATGTCACCATATCCAGG - Intergenic
976639156 4:87319272-87319294 GTTTTAATATGAGCATTCCCTGG - Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
979111484 4:116762602-116762624 GTACTTATGTGACCCTCCCCAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983708571 4:170687742-170687764 GTTCTAGTGTGTACATACTCTGG + Intergenic
984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
989217641 5:38921706-38921728 GGACTGGTGTGACCATACCCAGG + Exonic
991705148 5:69350411-69350433 GGTATATTGTGACCAGACCCCGG + Intergenic
994235039 5:97353366-97353388 GTTCTAATTTGATCATACTGTGG + Intergenic
997303328 5:132822313-132822335 GTTCTCATGTGGCCTCACCCAGG - Exonic
998968684 5:147567998-147568020 GTGCTAATGAGACCACAGCCAGG - Intergenic
1004556215 6:16701010-16701032 GTTCAGATATTACCATACCCAGG - Intronic
1004918031 6:20350378-20350400 GTTCTCATTTGAACATACACAGG + Intergenic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1011565429 6:88667561-88667583 GTTCTAGTGTGTACATACTCTGG + Intronic
1012708868 6:102571784-102571806 GTTCTATTGGGATTATACCCAGG - Intergenic
1018917868 6:168148395-168148417 GTTAAAAGGTGACCATACGCTGG + Intergenic
1019254224 7:39143-39165 TTTCAAATGTGAATATACCCAGG - Intergenic
1027900884 7:84113020-84113042 GTTGTACTGTTACCATGCCCTGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1039278477 8:35956901-35956923 GTTCTAGTGTGTGCATACGCTGG + Intergenic
1039332104 8:36549104-36549126 GTTATAATGTGCCCACAGCCTGG + Intergenic
1045628116 8:104081204-104081226 GTTCTTATGTGACTGGACCCTGG - Intronic
1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG + Exonic
1050707271 9:8415905-8415927 GTTGTAAAGTGACCATATCAAGG + Intronic
1053713298 9:40848618-40848640 GTTTTTATGTGAAGATACCCCGG - Intergenic
1054423687 9:64978975-64978997 GTTTTTATGTGAAGATACCCCGG - Intergenic
1054953139 9:70876085-70876107 GTTCTAATGTGACCATTTTAAGG + Intronic
1057330459 9:94109719-94109741 GTTATGATGTGACCATAGCATGG + Exonic
1062746178 9:138213398-138213420 TTTCAAATGTGAATATACCCAGG + Intergenic
1186927841 X:14354893-14354915 ATTTTAATGTTACCATGCCCAGG - Intergenic
1190314683 X:49142875-49142897 GTTCTAGTGTGTACATACTCTGG - Intergenic
1193897009 X:87127085-87127107 TTTCTATTGTTACCATACCTGGG - Intergenic
1200699268 Y:6388283-6388305 GTTCTAGTGTGTACATACTCTGG + Intergenic
1201034843 Y:9776415-9776437 GTTCTAGTGTGTACATACTCTGG - Intergenic
1201270414 Y:12248627-12248649 GTTCTAATGTGTACTTACTCTGG + Intergenic
1202037392 Y:20648608-20648630 GTTCTAGTGTGTACATACTCTGG + Intergenic