ID: 1010914152

View in Genome Browser
Species Human (GRCh38)
Location 6:81595129-81595151
Sequence GACCCAGGTGTGACCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010914148_1010914152 0 Left 1010914148 6:81595106-81595128 CCCAGACTGGAGTGCAGTAGTAT 0: 5
1: 419
2: 7990
3: 76373
4: 221486
Right 1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 163
1010914149_1010914152 -1 Left 1010914149 6:81595107-81595129 CCAGACTGGAGTGCAGTAGTATG 0: 4
1: 386
2: 7388
3: 68972
4: 164936
Right 1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010914152 Original CRISPR GACCCAGGTGTGACCCCGGC TGG Intronic
900118842 1:1040122-1040144 GACCTGGGTGCGACCCGGGCGGG + Intronic
900437236 1:2636832-2636854 CAGCCAGGTGTGGCCCAGGCAGG - Intronic
900575931 1:3382444-3382466 GACACAGCTGTGCCCCAGGCAGG - Intronic
902182438 1:14699262-14699284 CACCCAGGTGGGACCCAGGGAGG + Intronic
902619849 1:17644459-17644481 GACCCTGGTTTTACCCCAGCTGG + Intronic
903341226 1:22655759-22655781 GACCCAGGTGAGACCATGGATGG - Intronic
903776133 1:25794998-25795020 CACCCTGGAGGGACCCCGGCTGG - Intergenic
904291943 1:29492137-29492159 GAGCCAGGTAAGACCCCTGCAGG + Intergenic
904488213 1:30841582-30841604 GACCCAGGTGGGAACCCAGAAGG - Intergenic
905180060 1:36160091-36160113 GTCTCAGGTCTGACCCAGGCTGG + Intronic
909027129 1:70494975-70494997 GGCCCAGCTGTGACCCCTGCAGG + Intergenic
915932761 1:160070195-160070217 GGCCCAGCTCTGCCCCCGGCCGG - Exonic
916222409 1:162457948-162457970 GTCCCAGGTGTGAACCCGGGAGG + Intergenic
920387933 1:205581239-205581261 GACCCTGGACAGACCCCGGCAGG + Intronic
923067940 1:230537576-230537598 GTCCCGGGTGTTACCCAGGCAGG - Intergenic
923537185 1:234862438-234862460 GATCCAAATGTGACCCCGGAGGG + Intergenic
1063456388 10:6185558-6185580 GACCCAGATGAGCCCCTGGCTGG - Intronic
1067204391 10:44200694-44200716 GACCCAGGTGAGACCTCAGCAGG + Intergenic
1067770042 10:49116129-49116151 GTCCCAGGCCTGACCGCGGCGGG - Intergenic
1070335997 10:75455648-75455670 GACCCAGGTGAGACCTGGGTTGG + Intronic
1072190159 10:93071910-93071932 GACCCGCCTGTGACCCCTGCAGG - Intergenic
1076898392 10:133325291-133325313 GACCCAGGAGAGACCCCGTGGGG - Intronic
1077156395 11:1093893-1093915 CACCCAGGTGTGGCCCTGGGTGG + Intergenic
1077435487 11:2536833-2536855 GACCCAGGTGTGGGCAGGGCTGG + Intronic
1084872501 11:72107800-72107822 GAGACAGATGAGACCCCGGCTGG + Intronic
1085339522 11:75722136-75722158 GACCCAGGAGTGGGCCCTGCAGG - Intronic
1086446882 11:86879263-86879285 TACCCAGCTGCGACCCCGTCTGG + Intronic
1088377680 11:109159911-109159933 GACACAGGTGGGACACAGGCTGG + Intergenic
1088716817 11:112555881-112555903 TGCTCAGGTGTGACCCCTGCTGG + Intergenic
1088884513 11:113996514-113996536 GAGCCAGGTGTGGACCTGGCTGG - Intergenic
1090226508 11:125075152-125075174 GAACCAGGTGCGTCCCAGGCGGG + Intronic
1096805546 12:54138900-54138922 GACCCAAGTGTGAGCCTGGCAGG - Intergenic
1101998389 12:109541262-109541284 GACCAAGCAGTGACCCAGGCCGG + Intergenic
1102028244 12:109725611-109725633 GACCCAGGTGAGACCAGGCCAGG + Intronic
1104804340 12:131575491-131575513 GCCCCAGGTGTGACCCAGGGAGG - Intergenic
1108211545 13:48144602-48144624 GACACAGACGTGACCCTGGCAGG + Intergenic
1117985161 14:61379770-61379792 GTGACAGGTGTGACCCTGGCTGG - Intronic
1119424339 14:74526068-74526090 GACTCACCTGTGACCCAGGCAGG + Exonic
1122722055 14:103727674-103727696 GCCCCGGGTGTGGCCCCGGCTGG - Intronic
1122732927 14:103814853-103814875 GAGACAGGTGTGAACCCGGGAGG + Intronic
1125893840 15:43285913-43285935 GAGCCAGGTGTGACCCTGAGGGG + Intronic
1129295622 15:74598527-74598549 GACCCAGGGGTGCCCCTCGCAGG - Intronic
1129604643 15:77018925-77018947 AACCCAGGTGTGTCCCCTCCTGG - Intronic
1131290157 15:91100223-91100245 GATGCAGGTGTGACACCCGCCGG + Intronic
1132941295 16:2509712-2509734 GAGCCATGTGTGGCCCCAGCAGG - Intronic
1133394528 16:5435581-5435603 GACACAGGTGGGACCCAGGAGGG + Intergenic
1136050274 16:27645250-27645272 GACGCAGGTGAGCCCTCGGCTGG - Intronic
1139422181 16:66855680-66855702 GACCCAGATGAGACAGCGGCAGG + Intronic
1141512396 16:84521095-84521117 TACCCAGGTGTTACCATGGCTGG + Intronic
1141906335 16:87029187-87029209 GTCCCAGGTGTGGCCCTGGAGGG - Intergenic
1142582747 17:952195-952217 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582766 17:952259-952281 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582785 17:952323-952345 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582804 17:952387-952409 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582823 17:952451-952473 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582842 17:952515-952537 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582859 17:952579-952601 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582878 17:952643-952665 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582895 17:952707-952729 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582913 17:952772-952794 GACCAAGGTTGGAACCCGGCAGG + Intronic
1142582930 17:952836-952858 GACCAAGGTTGGAACCCGGCAGG + Intronic
1143223729 17:5282622-5282644 GCCCCGGGGGTGACCCCGCCGGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150925469 17:69527683-69527705 GGCCCAGCTGTGACCCTGGGAGG + Intronic
1151927619 17:77210501-77210523 GACCCAGGTGCCACCACGGCAGG - Intronic
1152099168 17:78291128-78291150 GGCCCAGCTGTGACACTGGCAGG - Intergenic
1152544236 17:80992565-80992587 GACCCCGGCAGGACCCCGGCAGG - Intronic
1152695480 17:81741754-81741776 GACCCGGGTGTGGCCGCGCCTGG - Intergenic
1152754210 17:82080354-82080376 CACCCAGGTGAGAGCCAGGCTGG - Exonic
1155300749 18:24426786-24426808 GAGGCAGGTGAGGCCCCGGCGGG + Exonic
1160094108 18:75854950-75854972 GATCCAGGTGTCACCTTGGCCGG + Intergenic
1160236359 18:77089208-77089230 GACCCCTGTGTGGCCCTGGCTGG + Intronic
1160294730 18:77627591-77627613 GATCCAGGTGTGCCCCTCGCTGG + Intergenic
1160989577 19:1855086-1855108 GCCCCAGGCGGGACCCTGGCAGG + Intronic
1161405010 19:4086546-4086568 TCCCCAGGTGGGACCCAGGCCGG - Intergenic
1163110907 19:15160694-15160716 GACCCAGCTGGGGCCCCAGCCGG - Exonic
1163463318 19:17452345-17452367 GACCCAGGGGTGACCAAGACAGG + Intronic
1165061343 19:33206727-33206749 GTCCCAGGTGAGCCCCCGGAGGG + Exonic
1165274292 19:34734432-34734454 CCCCGCGGTGTGACCCCGGCCGG + Intronic
1166137587 19:40786754-40786776 GACTCAGGTGAGGCCCCGACCGG + Exonic
1166756735 19:45197042-45197064 GACCCAAGTGGGACCTCAGCAGG + Intronic
926432737 2:12805856-12805878 GAGTCAGGTGTGAACCCGGGAGG + Intergenic
928085780 2:28345401-28345423 GAGCCAGGTTTGACTCAGGCCGG - Intergenic
929486405 2:42359239-42359261 GAACCAGCTCTGACCCAGGCTGG - Intronic
932495543 2:72144213-72144235 GACCCGGGTGTGGCTCCCGCAGG - Exonic
934916065 2:98302077-98302099 GACCCCAGTGTGGCCCCAGCCGG + Intronic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
936088481 2:109486050-109486072 AACCCATGTGTGTCCCTGGCTGG + Intronic
938757323 2:134392847-134392869 GACCCAGGGGTGCCCCCTTCTGG - Intronic
948460754 2:238128898-238128920 GGCCCAGGTAGGCCCCCGGCAGG + Exonic
948504781 2:238421500-238421522 GACCCCAGTGTGACCTCTGCAGG + Intergenic
1169493247 20:6089286-6089308 GAGCCAGGTGTGGCCCCAGGTGG - Intronic
1171972510 20:31573126-31573148 AACCCAGGTGTGGCCGCGGCGGG - Intronic
1172066857 20:32227490-32227512 CACCCAGGTGTCACCCAGGCTGG - Intronic
1172811603 20:37652044-37652066 GAGACAGGTCTGACCCCTGCAGG - Intergenic
1173805807 20:45924600-45924622 AACCCAGCTGGGACCCAGGCTGG + Intergenic
1173936399 20:46869879-46869901 GATTCAGCTGTGACCCAGGCTGG - Intergenic
1174558844 20:51415590-51415612 GGCCCAGCTGTGAGCCAGGCTGG - Intronic
1175915865 20:62425496-62425518 GGCCCAGCTGTGGCCCTGGCAGG + Intronic
1176297858 21:5083749-5083771 GCCCCAGGTGAGGCCCCAGCAGG + Intergenic
1179484028 21:41698111-41698133 GGCTCAGGTGTGACTCAGGCAGG - Intergenic
1179859171 21:44178200-44178222 GCCCCAGGTGAGGCCCCAGCAGG - Intergenic
1180064442 21:45405467-45405489 GAGCCAGGTAAGACCCGGGCGGG + Intronic
1181026872 22:20131877-20131899 GACCCCGGCCCGACCCCGGCCGG + Intronic
1181438568 22:22924145-22924167 AACCCAGGCCTGACCCCTGCAGG - Intergenic
1183451581 22:37898886-37898908 GACCCAGGCCTCACCCAGGCGGG + Intergenic
950547366 3:13646401-13646423 GACCCAGGTGTGGGCCCCACAGG - Intergenic
951507028 3:23458505-23458527 GAGCATGGTGTGAACCCGGCAGG - Intronic
967987504 3:195106581-195106603 GACACAGGCGAGACCCCTGCCGG + Intronic
968286758 3:197513337-197513359 CATCCAGGTGTGTCCCCGGGAGG + Intronic
968286769 3:197513370-197513392 CATCCAGGTGTGCCCCCGGGAGG + Intronic
968286781 3:197513403-197513425 CATCCAGGTGTGCCCCCGGGAGG + Intronic
968286795 3:197513436-197513458 CATCCAGGTGTGCCCCCGGGAGG + Intronic
968286807 3:197513469-197513491 CATCCAGGTGTGCCCCCGGGAGG + Intronic
968286819 3:197513502-197513524 CATCCAGGTGTGTCCCCGGGAGG + Intronic
968286830 3:197513535-197513557 CATCCAGGTGTGTCCCCGGGAGG + Intronic
969220101 4:5753637-5753659 AACCCAGGTGTGTCACCAGCAGG + Intronic
971384834 4:26133086-26133108 AACCTCGGTGTGACCCAGGCAGG + Intergenic
971771136 4:30898678-30898700 GACACTGGTGTGAACCCGGGAGG - Intronic
976319756 4:83700246-83700268 CACCCAGCTGTCACCCAGGCTGG + Intergenic
986527218 5:8692829-8692851 GAGGCAGGTGTGAACCCGGGAGG + Intergenic
986684496 5:10264243-10264265 GAGACAGGTGTCACCCAGGCTGG - Intronic
997611320 5:135217786-135217808 GCCCCAGGTGCAACCCTGGCTGG - Intronic
998208324 5:140175309-140175331 GACCCAGCTGGGACCAGGGCGGG + Intronic
1003174643 6:3745699-3745721 GACCCAGCTGTGTCCCAGGTGGG + Intronic
1006829355 6:36959360-36959382 CACGCAGGTGTGGGCCCGGCGGG + Exonic
1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG + Intronic
1013633824 6:112009977-112009999 GAGCAAGGTGTGAACCCAGCTGG - Intergenic
1018669952 6:166169273-166169295 GACCCCGGAGCGAGCCCGGCTGG - Intergenic
1019095706 6:169577465-169577487 GTCCCAGGTGTAACCACAGCGGG + Intronic
1019100464 6:169625571-169625593 GACACAGGACTGACCCCGTCGGG - Intronic
1019418212 7:936996-937018 CACCCAAGTGAGCCCCCGGCCGG + Intronic
1019442261 7:1053291-1053313 GACGCAGGTGTGGCGACGGCGGG + Intronic
1019711372 7:2519633-2519655 GACCCACGTGGGGCCGCGGCTGG - Intronic
1020043137 7:5019337-5019359 AACTCAGGTGTGACCCTGGGGGG - Intronic
1023096830 7:36669959-36669981 GACCCAGCTGTGTCACTGGCTGG + Intronic
1023177407 7:37448014-37448036 GACCCCGGTGTGTCCCCGGGAGG + Intronic
1023984041 7:45085131-45085153 GACCCAGGTGGGGACCTGGCTGG - Exonic
1024295213 7:47836309-47836331 GACCCAGCGGTGAACCCGGTGGG + Intronic
1027672477 7:81118897-81118919 AAGCCAGGTGTGGCCCAGGCAGG - Intergenic
1030716830 7:112817595-112817617 GACCTAGCTGTCACCCAGGCTGG + Intergenic
1032595728 7:133237876-133237898 CACCCAGCTGTCACCCAGGCTGG - Intergenic
1035333583 7:158112083-158112105 GACCCAGGTGTGGGCAGGGCTGG - Intronic
1035448163 7:158957081-158957103 GAGCAAGGTGGGACCCAGGCCGG - Intergenic
1036655799 8:10676535-10676557 GACCCAGGTGTGCCTAAGGCTGG - Intronic
1036933566 8:12979223-12979245 GGCCCAGTTTTGACCCCTGCAGG + Intronic
1037637780 8:20715958-20715980 CACCCAGGTGTATCCCCTGCTGG + Intergenic
1039800344 8:40949146-40949168 GGACCAGGTGGGACCCTGGCAGG + Intergenic
1040291904 8:46129834-46129856 CACCCAGGGGTGTCCCGGGCAGG - Intergenic
1040301265 8:46189206-46189228 CACCCAGGTGTGTCCAGGGCAGG + Intergenic
1040325833 8:46341067-46341089 CACCCAGGGCTGTCCCCGGCAGG + Intergenic
1041189637 8:55340876-55340898 GACACATGTGTGACCCATGCAGG - Intronic
1048469956 8:134696763-134696785 GACCTAGGAGGGACCCCTGCTGG - Intronic
1048998100 8:139806577-139806599 CATCCAGGTGTGACCTCAGCTGG + Intronic
1049041904 8:140118867-140118889 GCCGCAGGTGGGACCCGGGCTGG - Intronic
1050067171 9:1771969-1771991 GCCCCAGGTGTGACTCCAGTGGG - Intergenic
1051641680 9:19230282-19230304 GACCCCTGTGCGACCCCCGCGGG - Intergenic
1053429462 9:38032605-38032627 TCCCCAGGTGTGGCCCGGGCAGG - Intronic
1055554503 9:77461113-77461135 GTCCCAGGTGGGTCCCCAGCAGG + Intronic
1055891941 9:81132993-81133015 GACCCATCTGTGAACCAGGCTGG - Intergenic
1060652144 9:125337446-125337468 GACCCATGAGTGACCCCAGCTGG + Exonic
1061324892 9:129857761-129857783 GCCCCAGCTGGGACCCCGCCTGG + Intronic
1061961699 9:133992059-133992081 GTCCCAGGTGAGCGCCCGGCGGG - Exonic
1062030434 9:134359714-134359736 GAGCCACGTGTGGCCCTGGCGGG + Intronic
1062368524 9:136224112-136224134 GACCCTGGTGTGCTTCCGGCAGG - Exonic
1062608221 9:137358311-137358333 GACACAGGTGAGACCCTTGCTGG - Intronic
1185492835 X:532008-532030 GACGCAGGTGAGACCCCCTCTGG + Intergenic
1185873643 X:3684683-3684705 GACCCAGGTGTGGGCAGGGCTGG + Intronic
1186099017 X:6135182-6135204 GACCCAGGAGTGTCCCAGGAGGG + Intronic
1186422656 X:9438739-9438761 GATCAAGGTGTGAGCACGGCTGG + Intergenic
1187682369 X:21780191-21780213 GACCCAGTTGTGACTTCTGCTGG - Intergenic
1189348636 X:40261062-40261084 GTCCCAGCTCTGACCCTGGCTGG + Intergenic
1189756417 X:44276225-44276247 GACCCATGTGTCACCCAGGCTGG - Intronic
1190798033 X:53761826-53761848 CACTCAGGTGTGACCCTGACGGG + Intergenic
1190917125 X:54819383-54819405 CACTCAGGTGTGACCCTGACGGG - Intergenic
1199638670 X:149838292-149838314 AACCCAGGTGTGAACCCAGGAGG - Intergenic