ID: 1010916119

View in Genome Browser
Species Human (GRCh38)
Location 6:81621329-81621351
Sequence TGTTCCAGGTTACCAGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010916119_1010916125 -7 Left 1010916119 6:81621329-81621351 CCTGTTGCTGGTAACCTGGAACA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1010916125 6:81621345-81621367 TGGAACACAGTGGGGATGGCTGG No data
1010916119_1010916128 21 Left 1010916119 6:81621329-81621351 CCTGTTGCTGGTAACCTGGAACA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1010916128 6:81621373-81621395 CAGTTAAGTCATGATCATTTTGG 0: 1
1: 0
2: 1
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010916119 Original CRISPR TGTTCCAGGTTACCAGCAAC AGG (reversed) Intronic
906047590 1:42843867-42843889 TGTACCTAGTTACCATCAACAGG - Exonic
907595322 1:55714185-55714207 TGTTTAGGGTTACCAGCAAGTGG + Intergenic
907796344 1:57721707-57721729 TGCTGCAGGTGACCAGCTACTGG - Intronic
911898889 1:103475175-103475197 TGGGCCAGGTTACCAGAAAGGGG + Intergenic
912251332 1:108015270-108015292 TGTTCCAGGATTCAAGCAAAGGG + Intergenic
912843157 1:113057201-113057223 AGTTCCAGCTGACCAGCCACTGG - Intergenic
918086713 1:181251754-181251776 TGTTCCAGGTTCCCAGGTATTGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1064593902 10:16923545-16923567 TGTTTCAGGTTGCCAAGAACAGG + Intronic
1064602662 10:17009271-17009293 GGCTCCAAGTTTCCAGCAACTGG + Intronic
1067312929 10:45132134-45132156 TGTTTCAGGTTGCCAACAATAGG - Intergenic
1074913117 10:117929763-117929785 TGTAACAGATTACCACCAACTGG + Intergenic
1078940650 11:16001444-16001466 TGCTTCATATTACCAGCAACTGG - Intronic
1084223891 11:67702844-67702866 TGTTCCAGGTTCCCAGGTATTGG - Intergenic
1084791702 11:71478945-71478967 AGCTCCAGGTTACCAGCAGCAGG - Intronic
1084802986 11:71557867-71557889 TGTTGCAGGTAACCACTAACTGG + Intronic
1085796040 11:79540865-79540887 TCTTCCAGGTGAGCAGCAGCTGG + Intergenic
1087680587 11:101214765-101214787 TGTTCCAGGTTCCCAGGTATTGG + Intergenic
1087794222 11:102438600-102438622 TGTTAAAAATTACCAGCAACGGG + Intronic
1087926419 11:103923771-103923793 TGTTCCAGGTAAGCAGTTACTGG + Intronic
1088636395 11:111825083-111825105 AGTACCAGGTTACAAGCACCTGG - Intronic
1091074084 11:132598341-132598363 TGTTCCAGGTAGCCTGCAAGGGG - Intronic
1091285726 11:134407815-134407837 TGTTTCACGTTCCCAGCACCTGG + Intronic
1092817527 12:12324462-12324484 TGGTACAGGTGATCAGCAACTGG + Intergenic
1093785755 12:23190175-23190197 TTTTCCAGGTTATCAGCTATAGG - Intergenic
1096665421 12:53160913-53160935 TTTTCCAGGTCCCCAGCAAAGGG + Intronic
1098162512 12:67658724-67658746 TCTTTCAGGTTACCAGCATCAGG - Exonic
1100807055 12:98296554-98296576 AGTTTCAGTTTAACAGCAACAGG - Intergenic
1103242476 12:119425887-119425909 TGCTCATGGTTACCAGCAGCAGG - Intronic
1118552071 14:66964050-66964072 TGTTCTGGGCTACCAGTAACGGG - Intronic
1119630505 14:76227872-76227894 TGGACCAGGTGACCTGCAACGGG - Intronic
1120119581 14:80662965-80662987 TTTTCCAGTATACAAGCAACTGG - Intronic
1126381999 15:48058388-48058410 TGTTCCATGTGAGCAGCCACTGG + Intergenic
1127143124 15:55997041-55997063 TGTTCCAGGTTACAAGGCAGAGG + Intergenic
1129302283 15:74632288-74632310 TGTTTCAGGTTTACAGCCACTGG - Exonic
1129928336 15:79385653-79385675 TCTTCGAGGTTGCCAGGAACAGG - Intronic
1132298461 15:100761814-100761836 TCTTCCGGGTCACCAGCAGCTGG + Intergenic
1141795787 16:86273116-86273138 TGCCTAAGGTTACCAGCAACTGG - Intergenic
1143739955 17:8945256-8945278 TGTGCCAGGAAACCAGCCACTGG + Intronic
1152809122 17:82372872-82372894 CAGTCCAGGTTCCCAGCAACAGG + Intergenic
1161135283 19:2615969-2615991 TGTTCCAGGTCACCAGATCCTGG - Intronic
1163941947 19:20503237-20503259 TGTTCCAGGTTCCCAGGTATTGG + Intergenic
1166592228 19:44009592-44009614 TGTTATTTGTTACCAGCAACAGG - Intronic
927613290 2:24563937-24563959 TGTTCCACTTTACCTGAAACTGG + Intronic
938050683 2:128167867-128167889 TGTTCTAGGTGATCAGCAACAGG - Intronic
941346561 2:164376340-164376362 TGTTCCACTTAACCAGCAACTGG + Intergenic
942915893 2:181306193-181306215 TGTTCCAAATTACCACCAAATGG + Intergenic
947747371 2:232515601-232515623 TGTTACAAGTTACCACAAACTGG + Intergenic
1175520350 20:59598812-59598834 TTTTCCAGGTGACCAGCAGAGGG + Intronic
1178383212 21:32128833-32128855 TGTAACAGGTTACCATAAACTGG - Intergenic
1179026508 21:37683295-37683317 TGGCCCTGGTTACCAGCAAGAGG + Intronic
1180854864 22:19039326-19039348 TATACCAGGTTCCCAGCCACAGG - Intronic
1180931948 22:19598262-19598284 TGTTCCTGGATGCCAGCATCTGG - Intergenic
1180991372 22:19939026-19939048 TGTTCCAGGTTCCCAGGTATTGG - Intronic
1182746940 22:32613323-32613345 TGGTACAGGGTACCAGCAGCAGG + Intronic
952689069 3:36182389-36182411 TGATCAAGGTTAACATCAACAGG - Intergenic
952797293 3:37252091-37252113 TATTCCATGTAACCAGCAGCTGG + Intronic
956064567 3:65383603-65383625 AGTTCCAGATTACCAGGAACAGG - Exonic
957523402 3:81349936-81349958 TGTTCCATGCCCCCAGCAACAGG + Intergenic
957981491 3:87517087-87517109 TGTCCAAGGTTACCAGAAGCTGG - Intergenic
959888287 3:111526999-111527021 TGTTCCAGGTTCCCAGGTATTGG - Intronic
960982674 3:123245891-123245913 TTTTCCAGCTCACCAGCGACTGG + Exonic
961380536 3:126493853-126493875 TGGTCGAGCTCACCAGCAACTGG - Intronic
961922929 3:130446784-130446806 TGTTCCAGGTTCCCAGGTATTGG + Intronic
963042257 3:141078451-141078473 TGCTCCAGATTCCCAGGAACCGG + Intronic
963655212 3:148039729-148039751 TCTTTCAGGTTACCACTAACAGG + Intergenic
964116773 3:153144213-153144235 TGTTCCTCTTTACCAGCATCTGG - Intergenic
964675915 3:159279601-159279623 TATACCAGGTTTACAGCAACAGG - Intronic
965165329 3:165189182-165189204 TGTTCCAGGACACCAGCCACGGG + Exonic
969626780 4:8309622-8309644 GGCTCCAGGTGACCAGCATCAGG + Intergenic
969866912 4:10082280-10082302 TGTGCCAGGCTCCCATCAACAGG + Intronic
970624959 4:17866572-17866594 TTTTCCAGGTTGCCTGGAACTGG + Intronic
971227618 4:24769525-24769547 TCTTCCATGTCACCAGCAATAGG - Intergenic
971310655 4:25523110-25523132 TGTCTGAGGTTACCAGAAACTGG + Intergenic
980978653 4:139635133-139635155 TGTTCCAGGTTTCCAGGTATTGG - Intergenic
981224567 4:142278105-142278127 TACTCCATGTTACCTGCAACTGG - Intronic
982802186 4:159719167-159719189 TATTATAGGTTACCAGCACCAGG + Intergenic
986804072 5:11291735-11291757 TGTTCCATGTTATCAGGTACTGG - Intronic
989565324 5:42895784-42895806 GGTTCCAGGGTACCAGCTTCAGG - Intergenic
992766352 5:80004374-80004396 TGTTCCAGGTCACCAACAGATGG - Intronic
994331384 5:98510423-98510445 TATGCCAGGATACCAGCAATGGG + Intergenic
999656060 5:153811717-153811739 TGTTCCACTTTACAAGCAAGAGG + Exonic
1001319025 5:170664999-170665021 TGTTCCAAGTCACAAGCATCAGG + Intronic
1002631259 5:180580887-180580909 CGTTCCAGCTTACCAGCAAAGGG + Intergenic
1003352387 6:5330203-5330225 TGTCCCAGGTTCCCATCAAGGGG - Intronic
1009502917 6:64439618-64439640 TGTTACAGGTTAACAGAAAAGGG + Intronic
1010916119 6:81621329-81621351 TGTTCCAGGTTACCAGCAACAGG - Intronic
1012502374 6:99903121-99903143 TGTTCCAGTTCACCAGCATAGGG + Intergenic
1013186133 6:107760185-107760207 TTTTCCATCTTACCAGAAACAGG - Intronic
1016193768 6:141305209-141305231 TGTTAAAGGTTTCCAGAAACTGG - Intergenic
1016863188 6:148742260-148742282 TGTTCCAGGTTGGCAGCAGAAGG - Intergenic
1019448304 7:1082778-1082800 TGTTCCATGTTCCCACCAAGGGG + Intronic
1020116090 7:5477269-5477291 TGGTCAAGGCTACCAGGAACTGG + Intronic
1025639692 7:63354580-63354602 AGTGCCAGGTTACCAGAGACTGG - Intergenic
1025643007 7:63393512-63393534 AGTGCCAGGTTACCAGAGACTGG + Intergenic
1025712430 7:63925639-63925661 AGTGCCAGGTTACCAGAGACTGG + Intergenic
1029799783 7:102934443-102934465 TGTTGCAGATTCCCAGGAACCGG + Exonic
1029880485 7:103803767-103803789 ATTTCCAGGATAACAGCAACTGG + Intronic
1029953377 7:104610922-104610944 TGTTCCAGACAACCAGAAACTGG - Intronic
1033934248 7:146563545-146563567 TGTTTCCAGGTACCAGCAACTGG - Intronic
1044672812 8:94700445-94700467 TGTTCCCAGCTACCAGCAGCTGG + Intronic
1044793159 8:95868595-95868617 TGTACCTGGTTTCCAGCATCAGG - Intergenic
1046563834 8:115873100-115873122 TGCACCAGGTTCCCAGCAAGGGG + Intergenic
1047301440 8:123616826-123616848 TGTACCAGATTTACAGCAACAGG - Intergenic
1051099295 9:13502738-13502760 TGCTCCAGGAAACCAGCAAGTGG - Intergenic
1051595762 9:18823270-18823292 GGTTCCAGGTTTACAGAAACTGG + Intronic
1052476643 9:28969622-28969644 TGGTCCAAGTTATCAGGAACAGG - Intergenic
1052687852 9:31777138-31777160 TGTTCCAGGTTCCCAGGTATTGG - Intergenic
1058195140 9:101965345-101965367 TGTTGCAGGTGACCAGAAATTGG + Intergenic
1059198765 9:112395421-112395443 TGTTCCAGGTTCCCAGGTATTGG + Intronic
1185535535 X:858601-858623 TGTTGCTGGCTACCAGCAAGAGG + Intergenic
1198611823 X:138410529-138410551 TGTTCCTTGTTACTAACAACAGG + Intergenic
1200420793 Y:2965108-2965130 TCTTGCAGGTCACCACCAACAGG - Intronic
1201142855 Y:11042821-11042843 TGTTCCAGCCAGCCAGCAACGGG - Intergenic