ID: 1010926215

View in Genome Browser
Species Human (GRCh38)
Location 6:81749932-81749954
Sequence CTCATTTACCACTCCATGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010926212_1010926215 -3 Left 1010926212 6:81749912-81749934 CCCATCAGGCACACTGTGCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 139
1010926213_1010926215 -4 Left 1010926213 6:81749913-81749935 CCATCAGGCACACTGTGCTCTCA 0: 1
1: 0
2: 1
3: 17
4: 239
Right 1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010926215 Original CRISPR CTCATTTACCACTCCATGAA GGG Exonic
903533139 1:24047465-24047487 CTTACTTGCCACACCATGAATGG - Intergenic
906676116 1:47694674-47694696 TTCCTTTGCCACTCCCTGAAAGG + Intergenic
915887992 1:159743859-159743881 CTCAGTTCCCACTCCACGCAAGG - Intergenic
916104335 1:161419950-161419972 CTCTTTGCCCACTCCATCAAGGG - Intergenic
919573383 1:199276446-199276468 CCCATTTACAACAACATGAATGG + Intergenic
922968859 1:229717254-229717276 CTCATTTTCCACCCTGTGAATGG - Intergenic
922983136 1:229845780-229845802 CTGAATTCCCACTCTATGAATGG - Intergenic
924473128 1:244360909-244360931 GTCATTTACAACAACATGAAGGG + Intronic
1063215147 10:3918008-3918030 GTCATTTGCCACAACATGAATGG - Intergenic
1063960930 10:11304958-11304980 TTCATTTACCTATCCAGGAATGG + Intronic
1066433393 10:35373855-35373877 CAGATTTTCAACTCCATGAAGGG + Intronic
1067971564 10:50976493-50976515 CTCATTGAACACTCCGTGGAAGG - Intergenic
1070950331 10:80425918-80425940 CTCCTTTACCACTGCATAGAGGG - Exonic
1074017932 10:109553524-109553546 CTCATTTACAACAACATGGATGG - Intergenic
1076353448 10:129834460-129834482 TTCATTTTCTCCTCCATGAAAGG - Intergenic
1078946420 11:16072935-16072957 CACATTTAGCACTCCCTTAAGGG - Intronic
1088394800 11:109354934-109354956 GTCATTTACGACATCATGAATGG + Intergenic
1089268301 11:117282656-117282678 CTTATTTCCCAGTCCAGGAAAGG - Intronic
1090446558 11:126769557-126769579 TTCATTTACCACTGAATGCATGG + Intronic
1091096837 11:132831293-132831315 CTCATTTAGCAGACAATGAAAGG + Intronic
1095650528 12:44603718-44603740 TTCATTTACCACTTCACAAAAGG - Intronic
1097276146 12:57814767-57814789 CTGATTTATCACTGCATGTATGG + Intronic
1097281900 12:57850179-57850201 CTCATTTACCCCTCCTTGCTGGG - Intergenic
1099966932 12:89457288-89457310 CTTATTTACCACTATATTAATGG + Intronic
1101365043 12:104063756-104063778 CTCATTTCCCCGTCCATGAAAGG + Intronic
1109365493 13:61350792-61350814 CTCAATTACCTCTACCTGAATGG - Intergenic
1109368869 13:61395628-61395650 TTCATTAACCAAACCATGAATGG - Intergenic
1111698178 13:91652289-91652311 CTTATTTACAATTTCATGAATGG + Intronic
1112411128 13:99164515-99164537 CCCATTCACCAGCCCATGAATGG + Intergenic
1119075075 14:71629472-71629494 CTCTTTTCCCTCCCCATGAATGG + Intronic
1121968218 14:98330270-98330292 ATCATTTTCCACTTCAGGAATGG + Intergenic
1124025200 15:25959444-25959466 CTCACTCACCACTCCCTCAAAGG - Intergenic
1124229967 15:27936054-27936076 CTCATGTAGTACTTCATGAAAGG - Intronic
1126095782 15:45088969-45088991 GTAATTTTCCACTCCATGCAAGG + Intergenic
1126221903 15:46223774-46223796 CTCATTTAACATTCCATGCCTGG + Intergenic
1127889031 15:63231295-63231317 TTCATTTACCTCTAAATGAATGG + Intronic
1138241106 16:55427837-55427859 CTCATTTACCTATCCATGGTTGG - Intronic
1139148375 16:64350311-64350333 CTCAATTACCACTCAATACACGG - Intergenic
1140803783 16:78513738-78513760 CTCATATACCCCTCTAAGAAGGG + Intronic
1143829478 17:9639607-9639629 CACATGAACCAATCCATGAATGG + Intronic
1149123060 17:53193437-53193459 CTCATTTACCATTCCAGAAATGG + Intergenic
1156444403 18:37224364-37224386 CTTCTTTGCCTCTCCATGAATGG + Exonic
1157646005 18:49272169-49272191 GTAACTTACCACTTCATGAATGG + Exonic
1159339168 18:67112451-67112473 CTCATTTGCAACACAATGAATGG - Intergenic
1163317545 19:16551640-16551662 CTCTTTTACGGCTTCATGAAAGG - Exonic
927284941 2:21347304-21347326 CCCATTTAACATCCCATGAATGG - Intergenic
929205366 2:39286012-39286034 CTTACTTACCACTTCAAGAAAGG - Intronic
930037105 2:47093166-47093188 CTCAATTACTCCACCATGAATGG + Intronic
931230911 2:60373735-60373757 CTCATTAACCAGGCCTTGAAAGG - Intergenic
934143242 2:89068846-89068868 CTGATTGTCCACTCCAGGAAGGG + Intergenic
934226000 2:90131709-90131731 CTGATTGTCCACTCCAGGAAGGG - Intergenic
935207445 2:100908708-100908730 CTCATTTAACACTGGATTAAAGG - Intronic
938214544 2:129499896-129499918 TTCATGTACCATTTCATGAAGGG - Intergenic
939908002 2:147942168-147942190 CTCATATGCCAGTCCATAAATGG + Intronic
943342638 2:186698930-186698952 CTCATTTGCAACAACATGAATGG - Intronic
946549291 2:220783037-220783059 CTCATTTTTCAACCCATGAAAGG - Intergenic
948524508 2:238562576-238562598 CTGATCTACCAATCCACGAAGGG - Intergenic
1168781998 20:500494-500516 CTCATTTTACACTTAATGAAAGG - Intronic
1170110377 20:12798279-12798301 CTCAGTAATCACTCCACGAAAGG + Intergenic
1170290864 20:14766767-14766789 CTCATTTATCAGTCCAGGTAAGG + Intronic
1170335170 20:15262350-15262372 GTCATTTACAACACCATGGATGG - Intronic
1176899831 21:14426706-14426728 CTCATTTACAACCCCAACAATGG - Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
1181667506 22:24408318-24408340 AACAGTTACCACTCCATAAAGGG - Intronic
1182095227 22:27621402-27621424 ATCACTTACCACTCCCCGAAGGG + Intergenic
1184281825 22:43441821-43441843 CTCATTTGCCACTGCATGGAAGG + Intronic
951411210 3:22369678-22369700 CTCATTTATCCATACATGAATGG - Intronic
952442595 3:33347273-33347295 ATCATTTACAACAACATGAATGG - Intronic
952558056 3:34556352-34556374 CTCATTTTCTAGTCCATGAATGG + Intergenic
952817657 3:37459632-37459654 CTCAGCTTCCCCTCCATGAATGG - Intronic
957421274 3:79974798-79974820 CTCATTTTCCAATTCATGAAGGG - Intergenic
958505883 3:94976610-94976632 CTCATTTACAACAATATGAATGG + Intergenic
958530128 3:95318031-95318053 CTCATTTATGACAACATGAATGG + Intergenic
958995883 3:100904538-100904560 CACATTTACCATTCAATAAAAGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960361737 3:116720513-116720535 ATCATTTTCCACTTCTTGAAGGG + Intronic
963150070 3:142036266-142036288 CTTATTTACCATTCCCTGAATGG + Intronic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
965826825 3:172739442-172739464 CTCACTTCCAACTCCTTGAAAGG - Intergenic
967746450 3:193061060-193061082 CTCATTAAACACTCGCTGAATGG + Intergenic
969334916 4:6502175-6502197 CTCATTTACCCCACCCTGAGGGG - Intronic
970187010 4:13466867-13466889 CTCATTTGCAACAGCATGAATGG + Intronic
970985673 4:22154288-22154310 GTCATTTACAACAACATGAATGG + Intergenic
972317057 4:37936546-37936568 CAAATTTTCAACTCCATGAATGG - Intronic
974149471 4:57988055-57988077 CTCATTTACCGTGCAATGAAAGG + Intergenic
975519504 4:75284789-75284811 ATTATCTTCCACTCCATGAAAGG + Intergenic
977295910 4:95208906-95208928 CTCGTTGAACACTCAATGAATGG + Intronic
978645733 4:110929216-110929238 TGCATCTAACACTCCATGAAGGG + Intergenic
978839071 4:113187876-113187898 ATTATTTCCCACTTCATGAATGG - Intronic
979208329 4:118069831-118069853 CTTATTTCACACTCCATAAATGG + Intronic
982113220 4:152075063-152075085 CTCATTTAGCACACCTTGAAAGG - Intergenic
982383689 4:154777285-154777307 CTCTCTTAGCACTCCATGGATGG - Intergenic
984981208 4:185283328-185283350 CTTATTAAACACTCCATGCATGG - Intronic
985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG + Intergenic
987046743 5:14115916-14115938 CTCACTGACAAGTCCATGAAGGG - Intergenic
993583586 5:89695268-89695290 CTCATTCACCCCTGCATGATAGG - Intergenic
996492538 5:124115018-124115040 CTCATTGACCACTCTATGCTGGG - Intergenic
997105434 5:131013572-131013594 GTCATTTACGACACCATGGATGG + Intergenic
997203706 5:132028416-132028438 CACCTTTATCACTACATGAATGG + Intergenic
997865947 5:137462945-137462967 ATCCTTTTCCACTCCCTGAATGG - Intronic
998946662 5:147347344-147347366 CTAATTTACCACTCTAGGAGAGG - Intronic
999552678 5:152706299-152706321 CTCATTCCCCACTCCCTGACTGG + Intergenic
1000418723 5:161012657-161012679 CTCATTCACCATTCCATAAGTGG + Intergenic
1001079785 5:168659168-168659190 CTTATTTACCAGTCCCTGCAGGG - Intergenic
1001156873 5:169280155-169280177 TTCATTTGCCATTCAATGAAAGG + Intronic
1008051184 6:46901891-46901913 GCAATTTACCACTCCATGTAAGG + Intronic
1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG + Exonic
1012297226 6:97540067-97540089 CTTGCTTACCTCTCCATGAAAGG + Intergenic
1012820104 6:104076264-104076286 CTCATTTGCAACAACATGAATGG + Intergenic
1012894241 6:104930741-104930763 CTCTTTTAAGATTCCATGAAGGG - Intergenic
1012928607 6:105293744-105293766 CTCAATTACCATTCCATCAATGG - Intronic
1015676217 6:135752608-135752630 CATATTTACCACAACATGAACGG + Intergenic
1016623211 6:146136083-146136105 CTCATTTCCAACAACATGAATGG - Intronic
1018360590 6:163063345-163063367 CTCATCTTCCACTCCAGGATGGG + Intronic
1024350241 7:48356030-48356052 CTCATTTACCTCTTCATGGGAGG - Intronic
1026569270 7:71515179-71515201 CTAATACACCACTCCATGATTGG + Intronic
1028036742 7:85993283-85993305 GTCATTTACGACAACATGAATGG - Intergenic
1030417652 7:109265501-109265523 CTCATTTTTGATTCCATGAATGG - Intergenic
1030493280 7:110265649-110265671 CTCATTAATCTCTCCAGGAAAGG - Intergenic
1030588005 7:111445634-111445656 CCCTTTTAGCACTCCATAAAAGG - Intronic
1030609161 7:111669901-111669923 CTCAATTTCCACTTCATGTATGG - Intergenic
1033741364 7:144278089-144278111 CTCATTTACTTATCCATTAATGG + Intergenic
1033752539 7:144371525-144371547 CTCATTTACTTATCCATTAATGG - Intronic
1033800853 7:144900137-144900159 GTCATTTACGACAACATGAATGG - Intergenic
1037356799 8:18029213-18029235 CTCATTTAATACTCCTTGAATGG - Intronic
1038714112 8:29976214-29976236 CTCAGTCACAACTCCAGGAAAGG + Intergenic
1039794327 8:40899179-40899201 GTCATTTACAACACCATGGATGG + Intergenic
1042856998 8:73277701-73277723 CTCCTTTACCACTGCATAGAGGG + Intergenic
1043524610 8:81083054-81083076 CTCTGTTACCACTCCCAGAAGGG + Intronic
1046486241 8:114892561-114892583 CACATTTACCACTCCTTTCAGGG + Intergenic
1046952968 8:120035500-120035522 CTCCTTTACCACTGAAGGAAAGG - Intronic
1050263682 9:3867872-3867894 CTCATTTAGCATCCCATGAGAGG - Intronic
1050371623 9:4927691-4927713 CTCTTTTACCACTTCATGAGAGG - Intergenic
1050778859 9:9304870-9304892 CTCAATAATCTCTCCATGAAAGG + Intronic
1053432418 9:38051794-38051816 CACATTCACCACTCCATCAGAGG - Intronic
1053472927 9:38359699-38359721 CTAAGTTAGCCCTCCATGAAAGG - Intergenic
1056181005 9:84082139-84082161 CTCCTTTACCCATCCAAGAAAGG - Intergenic
1058284965 9:103166283-103166305 GTCATTTGCAACTACATGAATGG - Intergenic
1060881933 9:127123372-127123394 CTCATTTACCGATGCATGGAAGG - Intronic
1062033401 9:134372117-134372139 CTCAGTTTCCCCTCCATAAATGG - Intronic
1185830325 X:3295797-3295819 CTCATTCCCCACTCAATAAAGGG - Intergenic
1186943730 X:14541348-14541370 CTCATTTCCCACTCCTTGGCTGG + Intronic
1190641995 X:52488795-52488817 CTCATTTGCAAAACCATGAATGG - Intergenic
1192249041 X:69396096-69396118 CCCATGTACCACCTCATGAATGG + Intergenic
1193349464 X:80443441-80443463 TTCATTCACAACTCCATGCAAGG - Exonic
1193867552 X:86754729-86754751 CTTATTTACCACAACATGGATGG - Intronic
1193888673 X:87015949-87015971 CTCATTTACAGCAACATGAATGG + Intergenic
1193923713 X:87461031-87461053 CTCCTTTACCCCTCCATAATTGG + Intergenic
1196232920 X:113245552-113245574 GTCATTTACAACAACATGAATGG - Intergenic
1200799149 Y:7369924-7369946 GTCATTTACAGCACCATGAATGG - Intergenic