ID: 1010931212

View in Genome Browser
Species Human (GRCh38)
Location 6:81805639-81805661
Sequence GGTGATCTGCAGGAGTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010931212_1010931215 5 Left 1010931212 6:81805639-81805661 CCTGTCAACTCCTGCAGATCACC No data
Right 1010931215 6:81805667-81805689 AAAGTACTTAAAACAGTATCTGG No data
1010931212_1010931217 30 Left 1010931212 6:81805639-81805661 CCTGTCAACTCCTGCAGATCACC No data
Right 1010931217 6:81805692-81805714 TTTAGTGAGCATTCGATGCATGG No data
1010931212_1010931216 6 Left 1010931212 6:81805639-81805661 CCTGTCAACTCCTGCAGATCACC No data
Right 1010931216 6:81805668-81805690 AAGTACTTAAAACAGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010931212 Original CRISPR GGTGATCTGCAGGAGTTGAC AGG (reversed) Intergenic
No off target data available for this crispr