ID: 1010931928

View in Genome Browser
Species Human (GRCh38)
Location 6:81814252-81814274
Sequence GATCCTACCCTCAAGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010931928_1010931933 19 Left 1010931928 6:81814252-81814274 CCAGACCCCTTGAGGGTAGGATC No data
Right 1010931933 6:81814294-81814316 AAACCCTCCAAGTGACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010931928 Original CRISPR GATCCTACCCTCAAGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr