ID: 1010934892 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:81849530-81849552 |
Sequence | CTCCCTTCCAGGACCATGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010934884_1010934892 | 12 | Left | 1010934884 | 6:81849495-81849517 | CCAGGCAGGCTACTGATCTTGTA | No data | ||
Right | 1010934892 | 6:81849530-81849552 | CTCCCTTCCAGGACCATGAAGGG | No data | ||||
1010934882_1010934892 | 26 | Left | 1010934882 | 6:81849481-81849503 | CCAGAGAGATATGGCCAGGCAGG | No data | ||
Right | 1010934892 | 6:81849530-81849552 | CTCCCTTCCAGGACCATGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010934892 | Original CRISPR | CTCCCTTCCAGGACCATGAA GGG | Intergenic | ||