ID: 1010934892

View in Genome Browser
Species Human (GRCh38)
Location 6:81849530-81849552
Sequence CTCCCTTCCAGGACCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010934884_1010934892 12 Left 1010934884 6:81849495-81849517 CCAGGCAGGCTACTGATCTTGTA No data
Right 1010934892 6:81849530-81849552 CTCCCTTCCAGGACCATGAAGGG No data
1010934882_1010934892 26 Left 1010934882 6:81849481-81849503 CCAGAGAGATATGGCCAGGCAGG No data
Right 1010934892 6:81849530-81849552 CTCCCTTCCAGGACCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010934892 Original CRISPR CTCCCTTCCAGGACCATGAA GGG Intergenic