ID: 1010937760

View in Genome Browser
Species Human (GRCh38)
Location 6:81882240-81882262
Sequence CTGTTGGGACCTTTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010937760_1010937765 21 Left 1010937760 6:81882240-81882262 CCAGGAGAAAAAGGTCCCAACAG No data
Right 1010937765 6:81882284-81882306 TTGAACTTAAGTTACTATTATGG No data
1010937760_1010937763 -4 Left 1010937760 6:81882240-81882262 CCAGGAGAAAAAGGTCCCAACAG No data
Right 1010937763 6:81882259-81882281 ACAGAAATATTCAGTGAGAAAGG No data
1010937760_1010937766 22 Left 1010937760 6:81882240-81882262 CCAGGAGAAAAAGGTCCCAACAG No data
Right 1010937766 6:81882285-81882307 TGAACTTAAGTTACTATTATGGG No data
1010937760_1010937764 -3 Left 1010937760 6:81882240-81882262 CCAGGAGAAAAAGGTCCCAACAG No data
Right 1010937764 6:81882260-81882282 CAGAAATATTCAGTGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010937760 Original CRISPR CTGTTGGGACCTTTTTCTCC TGG (reversed) Intergenic
No off target data available for this crispr