ID: 1010938685

View in Genome Browser
Species Human (GRCh38)
Location 6:81890034-81890056
Sequence GGATGAAGGAAGTTTAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010938685_1010938689 7 Left 1010938685 6:81890034-81890056 CCCATCTTAAACTTCCTTCATCC No data
Right 1010938689 6:81890064-81890086 AATTATGTAATAGCTTGACCTGG No data
1010938685_1010938690 15 Left 1010938685 6:81890034-81890056 CCCATCTTAAACTTCCTTCATCC No data
Right 1010938690 6:81890072-81890094 AATAGCTTGACCTGGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010938685 Original CRISPR GGATGAAGGAAGTTTAAGAT GGG (reversed) Intergenic
No off target data available for this crispr