ID: 1010939152

View in Genome Browser
Species Human (GRCh38)
Location 6:81895610-81895632
Sequence ATTCTGTTATTAGTGAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010939149_1010939152 0 Left 1010939149 6:81895587-81895609 CCCGAACTTCAGACATTGCTGAA No data
Right 1010939152 6:81895610-81895632 ATTCTGTTATTAGTGAATCAGGG No data
1010939150_1010939152 -1 Left 1010939150 6:81895588-81895610 CCGAACTTCAGACATTGCTGAAA No data
Right 1010939152 6:81895610-81895632 ATTCTGTTATTAGTGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010939152 Original CRISPR ATTCTGTTATTAGTGAATCA GGG Intergenic
No off target data available for this crispr