ID: 1010940626

View in Genome Browser
Species Human (GRCh38)
Location 6:81912588-81912610
Sequence CATGATTTGTGGAGTCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010940621_1010940626 7 Left 1010940621 6:81912558-81912580 CCACAAACTCTCTCTTGATTATC No data
Right 1010940626 6:81912588-81912610 CATGATTTGTGGAGTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010940626 Original CRISPR CATGATTTGTGGAGTCAGGG TGG Intergenic
No off target data available for this crispr