ID: 1010941346

View in Genome Browser
Species Human (GRCh38)
Location 6:81921466-81921488
Sequence CCACCAGGGTGGAGTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010941337_1010941346 8 Left 1010941337 6:81921435-81921457 CCTGATGCCATACCAAGGCACCC No data
Right 1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG No data
1010941334_1010941346 24 Left 1010941334 6:81921419-81921441 CCTAGACTTCCACACTCCTGATG No data
Right 1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG No data
1010941335_1010941346 15 Left 1010941335 6:81921428-81921450 CCACACTCCTGATGCCATACCAA No data
Right 1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG No data
1010941338_1010941346 1 Left 1010941338 6:81921442-81921464 CCATACCAAGGCACCCGAATATC No data
Right 1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG No data
1010941339_1010941346 -4 Left 1010941339 6:81921447-81921469 CCAAGGCACCCGAATATCTCCAC No data
Right 1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010941346 Original CRISPR CCACCAGGGTGGAGTCAGAG AGG Intergenic
No off target data available for this crispr