ID: 1010945055

View in Genome Browser
Species Human (GRCh38)
Location 6:81964209-81964231
Sequence CATGCTGAACACATTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010945055_1010945057 -2 Left 1010945055 6:81964209-81964231 CCAATTTCAATGTGTTCAGCATG No data
Right 1010945057 6:81964230-81964252 TGATATCATATGCTCCATAAGGG No data
1010945055_1010945058 3 Left 1010945055 6:81964209-81964231 CCAATTTCAATGTGTTCAGCATG No data
Right 1010945058 6:81964235-81964257 TCATATGCTCCATAAGGGTAAGG No data
1010945055_1010945056 -3 Left 1010945055 6:81964209-81964231 CCAATTTCAATGTGTTCAGCATG No data
Right 1010945056 6:81964229-81964251 ATGATATCATATGCTCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010945055 Original CRISPR CATGCTGAACACATTGAAAT TGG (reversed) Intergenic
No off target data available for this crispr