ID: 1010945056

View in Genome Browser
Species Human (GRCh38)
Location 6:81964229-81964251
Sequence ATGATATCATATGCTCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010945053_1010945056 18 Left 1010945053 6:81964188-81964210 CCACCTCTATTACTGTATATACC No data
Right 1010945056 6:81964229-81964251 ATGATATCATATGCTCCATAAGG No data
1010945055_1010945056 -3 Left 1010945055 6:81964209-81964231 CCAATTTCAATGTGTTCAGCATG No data
Right 1010945056 6:81964229-81964251 ATGATATCATATGCTCCATAAGG No data
1010945054_1010945056 15 Left 1010945054 6:81964191-81964213 CCTCTATTACTGTATATACCAAT No data
Right 1010945056 6:81964229-81964251 ATGATATCATATGCTCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010945056 Original CRISPR ATGATATCATATGCTCCATA AGG Intergenic
No off target data available for this crispr