ID: 1010950627

View in Genome Browser
Species Human (GRCh38)
Location 6:82033046-82033068
Sequence CAGAGCCATCACCTTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010950624_1010950627 0 Left 1010950624 6:82033023-82033045 CCTGAATTAAAGCCATGACCAAG No data
Right 1010950627 6:82033046-82033068 CAGAGCCATCACCTTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010950627 Original CRISPR CAGAGCCATCACCTTCAAAG TGG Intergenic
No off target data available for this crispr