ID: 1010957971

View in Genome Browser
Species Human (GRCh38)
Location 6:82113156-82113178
Sequence TATTCTGAATCGTCTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010957971_1010957974 -10 Left 1010957971 6:82113156-82113178 CCCCAAGGAGACGATTCAGAATA No data
Right 1010957974 6:82113169-82113191 ATTCAGAATAGAATGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010957971 Original CRISPR TATTCTGAATCGTCTCCTTG GGG (reversed) Intergenic
No off target data available for this crispr