ID: 1010958361

View in Genome Browser
Species Human (GRCh38)
Location 6:82117346-82117368
Sequence CTATGTAGGCAGCTATTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010958356_1010958361 26 Left 1010958356 6:82117297-82117319 CCTGGTACGATGGTATATTAGGA No data
Right 1010958361 6:82117346-82117368 CTATGTAGGCAGCTATTGCAAGG No data
1010958359_1010958361 -8 Left 1010958359 6:82117331-82117353 CCTGAGACAGAGAGACTATGTAG No data
Right 1010958361 6:82117346-82117368 CTATGTAGGCAGCTATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010958361 Original CRISPR CTATGTAGGCAGCTATTGCA AGG Intergenic
No off target data available for this crispr