ID: 1010958389

View in Genome Browser
Species Human (GRCh38)
Location 6:82117718-82117740
Sequence TCAGGAGGACTTTGGACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010958389_1010958396 26 Left 1010958389 6:82117718-82117740 CCTGAAGTCCAAAGTCCTCCTGA No data
Right 1010958396 6:82117767-82117789 ATTGTTGAAGCCAAGGTTGTGGG No data
1010958389_1010958394 19 Left 1010958389 6:82117718-82117740 CCTGAAGTCCAAAGTCCTCCTGA No data
Right 1010958394 6:82117760-82117782 CCTGTCTATTGTTGAAGCCAAGG No data
1010958389_1010958395 25 Left 1010958389 6:82117718-82117740 CCTGAAGTCCAAAGTCCTCCTGA No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010958389 Original CRISPR TCAGGAGGACTTTGGACTTC AGG (reversed) Intergenic
No off target data available for this crispr