ID: 1010958390

View in Genome Browser
Species Human (GRCh38)
Location 6:82117726-82117748
Sequence AAGTGAACTCAGGAGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010958390_1010958395 17 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data
1010958390_1010958394 11 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958394 6:82117760-82117782 CCTGTCTATTGTTGAAGCCAAGG No data
1010958390_1010958396 18 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958396 6:82117767-82117789 ATTGTTGAAGCCAAGGTTGTGGG No data
1010958390_1010958397 23 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958397 6:82117772-82117794 TGAAGCCAAGGTTGTGGGTCAGG No data
1010958390_1010958398 27 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958398 6:82117776-82117798 GCCAAGGTTGTGGGTCAGGTAGG No data
1010958390_1010958400 28 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958400 6:82117777-82117799 CCAAGGTTGTGGGTCAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010958390 Original CRISPR AAGTGAACTCAGGAGGACTT TGG (reversed) Intergenic
No off target data available for this crispr