ID: 1010958392

View in Genome Browser
Species Human (GRCh38)
Location 6:82117736-82117758
Sequence TAAGACAGTCAAGTGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010958392_1010958400 18 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958400 6:82117777-82117799 CCAAGGTTGTGGGTCAGGTAGGG No data
1010958392_1010958396 8 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958396 6:82117767-82117789 ATTGTTGAAGCCAAGGTTGTGGG No data
1010958392_1010958395 7 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data
1010958392_1010958401 26 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958401 6:82117785-82117807 GTGGGTCAGGTAGGGTGTTCAGG No data
1010958392_1010958394 1 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958394 6:82117760-82117782 CCTGTCTATTGTTGAAGCCAAGG No data
1010958392_1010958397 13 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958397 6:82117772-82117794 TGAAGCCAAGGTTGTGGGTCAGG No data
1010958392_1010958398 17 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958398 6:82117776-82117798 GCCAAGGTTGTGGGTCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010958392 Original CRISPR TAAGACAGTCAAGTGAACTC AGG (reversed) Intergenic