ID: 1010958395

View in Genome Browser
Species Human (GRCh38)
Location 6:82117766-82117788
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010958389_1010958395 25 Left 1010958389 6:82117718-82117740 CCTGAAGTCCAAAGTCCTCCTGA No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data
1010958392_1010958395 7 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data
1010958391_1010958395 10 Left 1010958391 6:82117733-82117755 CCTCCTGAGTTCACTTGACTGTC No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data
1010958390_1010958395 17 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958395 6:82117766-82117788 TATTGTTGAAGCCAAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010958395 Original CRISPR TATTGTTGAAGCCAAGGTTG TGG Intergenic