ID: 1010958400

View in Genome Browser
Species Human (GRCh38)
Location 6:82117777-82117799
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010958391_1010958400 21 Left 1010958391 6:82117733-82117755 CCTCCTGAGTTCACTTGACTGTC No data
Right 1010958400 6:82117777-82117799 CCAAGGTTGTGGGTCAGGTAGGG No data
1010958390_1010958400 28 Left 1010958390 6:82117726-82117748 CCAAAGTCCTCCTGAGTTCACTT No data
Right 1010958400 6:82117777-82117799 CCAAGGTTGTGGGTCAGGTAGGG No data
1010958393_1010958400 -6 Left 1010958393 6:82117760-82117782 CCTGTCTATTGTTGAAGCCAAGG No data
Right 1010958400 6:82117777-82117799 CCAAGGTTGTGGGTCAGGTAGGG No data
1010958392_1010958400 18 Left 1010958392 6:82117736-82117758 CCTGAGTTCACTTGACTGTCTTA No data
Right 1010958400 6:82117777-82117799 CCAAGGTTGTGGGTCAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010958400 Original CRISPR CCAAGGTTGTGGGTCAGGTA GGG Intergenic