ID: 1010966780

View in Genome Browser
Species Human (GRCh38)
Location 6:82219324-82219346
Sequence CATTATAGGCATATATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010966780_1010966782 -10 Left 1010966780 6:82219324-82219346 CCCTACAATATATGCCTATAATG 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1010966782 6:82219337-82219359 GCCTATAATGACCCAGTATGTGG 0: 1
1: 0
2: 1
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010966780 Original CRISPR CATTATAGGCATATATTGTA GGG (reversed) Intronic
905098406 1:35496126-35496148 CATAACCGGCCTATATTGTATGG - Intronic
905324741 1:37143309-37143331 TATTTTAGACATATTTTGTAGGG + Intergenic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
909659733 1:78068763-78068785 CATTATAGGCATTTTTTGGAAGG + Intronic
910418119 1:87023683-87023705 CATGATAAGGATATATTGAATGG + Intronic
911327980 1:96491607-96491629 CATTATATACATATAATGTTGGG - Intergenic
912268454 1:108184410-108184432 ACTTAGGGGCATATATTGTAAGG + Intronic
912890866 1:113528862-113528884 TCTTATTGGCATATATTCTAAGG - Intronic
912926703 1:113919343-113919365 CATTCTGGGCATATATTCAAAGG + Intergenic
915303140 1:154962801-154962823 TTTTATATGCATATATTTTAGGG - Exonic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
923303076 1:232661309-232661331 AGTTATAAGCATATATTTTATGG + Intergenic
923785022 1:237058185-237058207 CAGTCTAGGGATATATTGGAGGG + Intronic
1067309566 10:45100278-45100300 GATTATTGGCACATATCGTAGGG + Intergenic
1071815335 10:89226256-89226278 CCTTCTAGGAATATATTGTAAGG + Intronic
1080207336 11:29745349-29745371 TATTATATGCATATATTGATAGG + Intergenic
1082126094 11:48432745-48432767 CATGATAGTCATATAGTGCAAGG + Intergenic
1082130588 11:48484268-48484290 TATAATAGGAATATCTTGTAGGG + Intergenic
1082559679 11:54603597-54603619 CATGATAGTCATATAGTGCAAGG + Exonic
1082564096 11:54655172-54655194 TATAATAGGAATATCTTGTAGGG + Intergenic
1082640250 11:55651283-55651305 CATGATGGTCATATAATGTAGGG - Exonic
1082695273 11:56355990-56356012 CCTTAAAGGCATGTTTTGTAGGG + Intergenic
1084739862 11:71132661-71132683 CATTTAAAGCAAATATTGTAAGG - Intronic
1086250832 11:84812324-84812346 CTTTATAGGCACATACTGTGTGG + Intronic
1089336856 11:117731121-117731143 CATTAAATGGGTATATTGTATGG + Intronic
1093962168 12:25286212-25286234 CATTATAGGTAAATGTAGTAGGG - Intergenic
1094456156 12:30635907-30635929 CTTTATTGGCTTATACTGTATGG - Intronic
1097772862 12:63609218-63609240 AACTATAGGCTTGTATTGTAAGG + Intronic
1098118350 12:67205511-67205533 AATTATAGGCAAAAATTATATGG + Intergenic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1098739154 12:74148937-74148959 TACTATAGACATAAATTGTAAGG - Intergenic
1099473607 12:83080840-83080862 GGTTATAGGCATATATTCAAGGG - Intronic
1099982857 12:89626936-89626958 CATTATGGTCATAAATTATAGGG - Intronic
1101156590 12:101933474-101933496 CATTACAGGCAGATACTGAAAGG - Intronic
1101357825 12:103997192-103997214 CATTATAGGCATACAGGGAAAGG + Intronic
1104315390 12:127695118-127695140 CATTATATGCATATTTTATATGG - Intergenic
1106100204 13:26688342-26688364 AATTATAGTTATAAATTGTAAGG + Exonic
1106757173 13:32834280-32834302 CTTTATAGCAATATATTGTTGGG - Intergenic
1108872453 13:55004161-55004183 CATTTTGGGCATATATTCTCAGG + Intergenic
1111592633 13:90369833-90369855 CATTACAGAAATATATTGGAGGG - Intergenic
1113033322 13:106018475-106018497 CATTTTAGGCATATGGTGAATGG - Intergenic
1114964887 14:27945088-27945110 TATTATTGGCAGACATTGTAAGG - Intergenic
1117705117 14:58457649-58457671 CATTATACCAATATATTCTAAGG - Intronic
1118969770 14:70624730-70624752 GAGTATAGGCATATACTATAGGG - Intergenic
1120079615 14:80201178-80201200 CATTATAATCATATACTATAGGG + Intronic
1120490034 14:85165631-85165653 CATTAGAGGCACAAAATGTATGG + Intergenic
1120672036 14:87373573-87373595 CAATATAGTCAGATAATGTAGGG - Intergenic
1130294816 15:82638773-82638795 TATTAAAGGCATATATTCAAGGG + Intronic
1134035777 16:11030197-11030219 CTGTATGGGCATACATTGTATGG - Intronic
1138324582 16:56153655-56153677 CCTTGCATGCATATATTGTATGG + Intergenic
1138372342 16:56537264-56537286 CACAAAAGGCAAATATTGTATGG + Intergenic
1139035185 16:62937517-62937539 CTTTATAAGAATATATTCTAGGG + Intergenic
1140951952 16:79826774-79826796 CATTGTAGGTATATGTTGTGAGG - Intergenic
1144442319 17:15294543-15294565 CATTATAGAACTATATTGAAGGG - Intergenic
1144466384 17:15500846-15500868 AATAATAAGCATATATTGCATGG - Intronic
1147972571 17:44227476-44227498 TTTTATATGCATATATTTTAGGG - Intergenic
1151166349 17:72206918-72206940 CATTTTAGGCATATACTTTTGGG - Intergenic
1154513230 18:15133428-15133450 CAGTAAAGCCATCTATTGTAGGG - Intergenic
1157879921 18:51311819-51311841 CATACTAGGTATATATTTTATGG - Intergenic
1158231954 18:55266480-55266502 AATTAGAGGAATATAATGTATGG - Intronic
1159378972 18:67631761-67631783 CTTTATAGGCAGATAATGTTGGG + Intergenic
1164297264 19:23923389-23923411 AATTACTGGCATCTATTGTATGG - Intronic
1164717266 19:30402306-30402328 CATTATAGCAATATAGTGGAGGG + Intronic
1165359712 19:35328772-35328794 CATCATAGGCATAAATGGTGGGG - Intronic
927345328 2:22031940-22031962 GCATATAGACATATATTGTATGG + Intergenic
932480306 2:72035213-72035235 CATTATATGCATGTATTCTATGG - Intergenic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
937713954 2:125010689-125010711 CATTATCTGCATTTATTCTAGGG - Intergenic
939301059 2:140339213-140339235 CTTTATAGGTGTAGATTGTAAGG + Intronic
939737820 2:145871424-145871446 AATTATAGGCATACATTTCAAGG - Intergenic
941614447 2:167703316-167703338 CCTTCTAGGCATCTAATGTAGGG - Intergenic
943165520 2:184319358-184319380 CATTATATGCTTATGTTGTAAGG - Intergenic
945140857 2:206684982-206685004 CATTGAAGGCATGTAATGTAGGG + Intronic
945860406 2:215114963-215114985 GATAAGGGGCATATATTGTATGG + Intronic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1170207736 20:13817452-13817474 CATTATTTGCAAATATTTTAGGG - Exonic
1173187555 20:40852527-40852549 CCTTATAGGCATGAATTGCAAGG + Intergenic
1175629186 20:60518801-60518823 AATTATAGCCATGTATTGTTAGG - Intergenic
1177201771 21:17965244-17965266 CTTTAGAGGCTTATAATGTAGGG - Intronic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
951066082 3:18267186-18267208 CATGAAATGCAAATATTGTAGGG - Intronic
951830026 3:26916317-26916339 CATTATAGCTGTATATGGTAGGG - Intergenic
953897466 3:46813098-46813120 TTTTATATGCATATATTTTAGGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957173060 3:76764951-76764973 TATTATGTGCATATATTGTGTGG + Intronic
957801157 3:85083912-85083934 CATTATAGGCTTATTTTTAATGG - Intronic
957925968 3:86811851-86811873 CATTATAAGTGTATATTTTATGG - Intergenic
958476095 3:94584943-94584965 CATTCTAGGCATACATTTTAGGG + Intergenic
958957890 3:100480940-100480962 AATTAAAGGGATCTATTGTATGG - Intergenic
959426773 3:106199728-106199750 GTTTATAGGAAGATATTGTATGG + Intergenic
959563575 3:107811244-107811266 CATTAAAGGCACATACTCTACGG - Intronic
962034193 3:131633338-131633360 CATTATAGGTACCCATTGTAAGG + Intronic
964301803 3:155296018-155296040 CTATATATGCATATATTATAAGG - Intergenic
964673281 3:159250336-159250358 CAATAAAGTTATATATTGTAGGG - Intronic
965222370 3:165943003-165943025 AATTAAATGCATATATTTTATGG + Intergenic
966253666 3:177893236-177893258 CATGTTTGGCAGATATTGTATGG + Intergenic
967549094 3:190768318-190768340 CATCATATGCATTTATTATACGG + Intergenic
967793123 3:193570345-193570367 CAATTTAGGCATATATTATGTGG - Intronic
970849692 4:20586564-20586586 CATTACAAGCATATAAGGTAAGG - Intronic
971835431 4:31756934-31756956 CATTAAAGGAATTTATTGAAAGG - Intergenic
972006852 4:34120183-34120205 CATTCAAGACATTTATTGTAGGG + Intergenic
972918660 4:43910126-43910148 CAATAAAGGCATATATTTTGAGG + Intergenic
974464340 4:62234643-62234665 CTTTATGAGCATATATTGAATGG - Intergenic
975192055 4:71475946-71475968 CCTTCTAGGCATACATTGTAGGG + Intronic
976200436 4:82572501-82572523 CATTAAATGGATATGTTGTATGG - Intergenic
977908823 4:102508133-102508155 AAGTATAGGCTTATTTTGTAAGG + Intronic
979291269 4:118981561-118981583 AATTAAGGGCATACATTGTATGG - Intronic
981617896 4:146661763-146661785 CAGTATAGACATATATAGCAAGG + Intergenic
983607033 4:169598766-169598788 CATTTTAGGAATATATAGTCTGG + Intronic
985940425 5:3131519-3131541 CATTATAGCCATATAATTGATGG + Intergenic
987812536 5:22856895-22856917 AATTACAGATATATATTGTAGGG + Intergenic
990477343 5:56174153-56174175 CTTTCTAGGAATATATTCTAAGG - Intronic
991261533 5:64673814-64673836 CATTAAATGGATAAATTGTATGG - Intergenic
991687286 5:69193256-69193278 CAATAAAGGCATCTATTTTAAGG + Intronic
994121872 5:96123497-96123519 CATTATTGGCATGCATTTTAAGG + Intergenic
994702813 5:103158513-103158535 CATCAGAGGCATATATTTTGAGG - Exonic
994902435 5:105792641-105792663 AAATATGGGCATATATTTTAGGG - Intergenic
995187072 5:109282513-109282535 CATTAAAGCCATATATTTAAGGG + Intergenic
995353218 5:111206373-111206395 CATCATAGACAGATATTGTTAGG + Intergenic
995944460 5:117626571-117626593 CATTATAAGCCTGTATTGTAAGG + Intergenic
997042043 5:130268070-130268092 CTTTATGGTCATATTTTGTAAGG + Intergenic
997169065 5:131696646-131696668 AATTTTAGGCATTTATTATATGG - Intronic
997780801 5:136656178-136656200 CATTATAGGCAAAAATAATAGGG - Intergenic
1000816997 5:165935813-165935835 CATTATAGGCATATTCTGAGAGG - Intergenic
1001365712 5:171137322-171137344 CATAATAGACATCTATTCTAGGG + Intronic
1004995897 6:21192727-21192749 GTTTATAGGCATATAGTTTATGG - Intronic
1005178956 6:23081514-23081536 TATAATATGCATATATTATAGGG - Intergenic
1006533653 6:34679399-34679421 AATTCTAGGAATAAATTGTAAGG + Intronic
1007437423 6:41825195-41825217 TATTAAAGGCAAATATTTTAAGG + Intronic
1008204245 6:48633769-48633791 TATAATAGGGTTATATTGTAGGG + Intergenic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009772173 6:68157935-68157957 CATTATGCAAATATATTGTATGG - Intergenic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1011994772 6:93571957-93571979 CATTCTAGGCTTAAATTTTATGG + Intergenic
1012562406 6:100599145-100599167 GATTATAGCCACATATTTTAGGG + Intronic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1012961276 6:105624638-105624660 CATTATGGGCAAATGTTGGAGGG + Intergenic
1014050662 6:116949895-116949917 AATGATAGGCATATATTGAATGG + Intergenic
1014473799 6:121848193-121848215 CATTCCAGGCATATTTTATAAGG - Intergenic
1017385030 6:153873484-153873506 CATTATTATCATATATTTTAAGG - Intergenic
1022617980 7:31952042-31952064 AATTACAGGCATATATTGAGAGG - Intronic
1022662438 7:32379527-32379549 CATTCTAGGCAACTCTTGTAGGG - Intergenic
1024191265 7:47013284-47013306 CATTATATACATATCTTATAAGG + Intergenic
1029828353 7:103225703-103225725 AACTATAGGCTTGTATTGTAAGG + Intergenic
1030912384 7:115266719-115266741 CCTTAGTGGCATATATTCTAAGG - Intergenic
1032611373 7:133418924-133418946 ATTTATGGGAATATATTGTAAGG + Intronic
1034082291 7:148290400-148290422 CATTATAGAGAAATATTTTAGGG - Intronic
1034516121 7:151581287-151581309 TATTCTAGGCATTTATTGCATGG + Intronic
1035946829 8:3972782-3972804 CATTTTAGGAATCTATTTTATGG + Intronic
1038423419 8:27449037-27449059 TGCTATAGGCATATATTGTGGGG + Intronic
1039157085 8:34572797-34572819 TATTATGGCCATATATTGTTTGG + Intergenic
1039502557 8:38029655-38029677 CATTATGGGCACATATTGTGGGG - Intergenic
1040355634 8:46615732-46615754 CATTATAATCATATATTATTTGG - Intergenic
1042759373 8:72254169-72254191 AAATATATGCATATATTGTTTGG + Intergenic
1045029661 8:98122712-98122734 CATTTAGGGCATCTATTGTAGGG + Intronic
1045647898 8:104317201-104317223 CATAGTAGGCATAAATTGTAAGG - Intergenic
1046332940 8:112745747-112745769 CATTATAGTCATATTTCCTAAGG - Intronic
1048514083 8:135089614-135089636 AATAATAAGCATATATAGTAGGG - Intergenic
1048747009 8:137625499-137625521 CATAATAGGGAGTTATTGTATGG + Intergenic
1051133179 9:13885953-13885975 CATTATTAGCTTATATTTTAGGG + Intergenic
1053340038 9:37318167-37318189 CATTATATGACTATATTGTAAGG - Intronic
1055127778 9:72738764-72738786 AATTATAGTCATATGTTGAAGGG + Intronic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1203562156 Un_KI270744v1:66446-66468 TATAATAGGCATATATATTATGG - Intergenic
1188935055 X:36165565-36165587 AATTATAGCAATATATTGTTGGG - Intergenic
1191741046 X:64435142-64435164 TTTTATATGCATATATTTTAGGG + Intergenic
1192045319 X:67665833-67665855 CATTTTATGCATATATTCCATGG - Intronic
1192065539 X:67880842-67880864 CATGATAGGCACATGTCGTAAGG - Intergenic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193439765 X:81525197-81525219 CAATATAGGCAAATAATTTATGG - Intergenic
1193644097 X:84046337-84046359 CATTATAGTCACATATTCCAGGG - Intergenic
1193935783 X:87619017-87619039 AAGTATTGGCATCTATTGTAAGG - Intronic
1194091963 X:89588541-89588563 GATTATTATCATATATTGTAAGG - Intergenic
1194338927 X:92685208-92685230 CAGTATAAGCATGTATTTTAAGG - Intergenic
1195558184 X:106251192-106251214 CATCTTAGGCATATATTCTCAGG + Intergenic
1196431286 X:115629489-115629511 CATTATAAGTGTTTATTGTATGG + Intronic
1199279381 X:145982008-145982030 CATTATAGCAATACATTGTTGGG + Intergenic
1200444601 Y:3244603-3244625 AATTATTATCATATATTGTAAGG - Intergenic
1200647320 Y:5801986-5802008 CAGTATAAGCATGTATTTTAAGG - Intergenic
1201144653 Y:11057501-11057523 CATTTAAAGCAAATATTGTAAGG - Intergenic