ID: 1010968307

View in Genome Browser
Species Human (GRCh38)
Location 6:82237264-82237286
Sequence AAGGTTTTACAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010968302_1010968307 4 Left 1010968302 6:82237237-82237259 CCAGCAGAAACTGAAAAAAAAAA 0: 1
1: 1
2: 38
3: 359
4: 3245
Right 1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG No data
1010968301_1010968307 12 Left 1010968301 6:82237229-82237251 CCAACTTTCCAGCAGAAACTGAA 0: 1
1: 0
2: 3
3: 39
4: 304
Right 1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010968307 Original CRISPR AAGGTTTTACAGATGGAAAA GGG Intronic
No off target data available for this crispr