ID: 1010977522

View in Genome Browser
Species Human (GRCh38)
Location 6:82332537-82332559
Sequence ATAGAGAAGAAGAAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010977522_1010977534 29 Left 1010977522 6:82332537-82332559 CCTTCTCCCTTCTTCTTCTCTAT No data
Right 1010977534 6:82332589-82332611 CCAGTCTACTTCCTATCTTCAGG No data
1010977522_1010977526 0 Left 1010977522 6:82332537-82332559 CCTTCTCCCTTCTTCTTCTCTAT No data
Right 1010977526 6:82332560-82332582 CCCCTCCCCTTTCCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010977522 Original CRISPR ATAGAGAAGAAGAAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr